The purpose of the control is to ..?

Answers

Answer 1
The control group is used as the constant variable

Related Questions

Which of the following below, best describes a cell from bacteria?
A. A multicellular organism

B. A cell with many organelles

C. Multicellular, Eukaryote

D. Unicellular, prokaryote

Answers

A multicellular organism

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA

Answers

Answer:

D

explanation: it literally has physics in its name

What is Pedigree?? Can someone help me i need this answer plzzzzzz

Answers

Answer:

A pedigree is like a lineage or a recorded ancestry. For example, if a dog has recorded breeding papers it would show you it's pedigree. I hope that helped! :)

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.

Answers

Caves

Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.

one is missing but u can just check it on quizlet

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY

Answers

Answer:

Freeze-thaw

Explanation:

Answer:

frost wedging

Explanation:

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to no jaws, no paired fins and scales on the body.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Plz help me its only 1 question

Answers

Answer:

the first one

Explanation:

the car slowly started and accelerated

Its the second one. Since its continually accelerating.

Any one free
InboX me (◍•ᴗ•◍)❤​

Answers

Answer:

hiii

Explanation:

In an earthworm is the dorsal blood vessel or the ventral blood vessel larger?

Answers

Answer:

Dorsal lol, its contracts and pumps blood to the aortic arches.

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults

The chemical equation for cellular respiration is:

glucose + oxygen ----> your mama

carbon dioxide + water
sunlight --->glucose + oxygen

oxygen + carbon dioxide glucose + water

glucose + oxygen --->carbon dioxide + water + ATP (energy)

Answers

Answer: The last one

Explanation:

Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)

Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.

(This is 7th grade science).

Answers

like your name

Explanation:

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
Not a long life story but a simple two reasons.

Answers

Answer:

1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.

2-They also don't reproduce independently but must replicate by invading living cells.

Viruses are considered non living since they are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy.
Other Questions
Substitute x=5 into the expression 4x-8 and simplify The vertices of a triangle are listed below:E(-1, 2), F(-5, -1), G(-1, -4)What is the area of the triangle? Can u help me understand how to write a function for the rule "the output is 3 less than 5 times the input" thanks :) How are integrated Steel plants different from mini steel plants? Can yall help me please?? I can't get it wrong! Is all squares are quadrilaterals? What is Thuys error?Thuy should have written the ratio as StartFraction 30 inches over 3 inches EndFraction.Thuy should have written the ratio as StartFraction 30 inches over 39 inches EndFraction.Thuy should have divided both numbers by 6.Thuy should have divided both numbers by 13. Number 11. Find angle GJK The image below shows plant cells.What feature of cells is best demonstrated in the image?OA Cells are the basic units of structure and make up tissues.OB. All organisms are made up of a large number of cells.OC. All organisms have cells with different shapes and functions.OD. Cells are formed from other cells within the same tissue.2021 Edmentum. All rights reserved. JKLM is a rhombus. Find JK. PLZ HELP! Ms. Gregg spent $14 buying fruit Apples cost $2 per pound Bananas cost $1 per pound. What are some possible amounts of pounds of apples andbananas that Ms. Gregg could have bought? Answer right I will cashapp $5 Someone made a copy of an analog wave and a digital wave. Compare the copieswith the original waves. Then, explain which type of wave is a more reliable way toencode and transmit information. Im just doing it for my niece but who knows it The wildflowers began blooming by my house at the beginning of March. The first week there were 88 blooms. After week two, there were 176 flowers in bloom. If the flowers continue to bloom at the same rate each week, how many flowers will there be after 6 weeks? lee and Celia are lab partners. While Celia pours a chemical into a graduated cylinder, some of the chemical splashed onto her arm . What should happen next? Which of the following phrases best defines migration A forcing others to move away from their homes B encouraging others to move to a new place C spreading culture from one place to another D moving from one place to another to find a new place to live Please select the best answer from the choices provided ABCD How do the Rocky mountains affect the development and population of those areas in North America? A regular octagonal pyramid. Each side of the base is 6 cm long. it has a height of 10cm. Find the surface area of the pyramid A book costs $ 25.00. You have a coupon for 30 % off. Calculate the final price of the book with a 5% GST. (Begin by finding the discount price and then adding the GST) HELP ASAP!! Ill give brainliest