The process of photosynthesis converts carbon atoms from carbon dioxide into

Answers

Answer 1
Sugar
It for plant to eat

Related Questions

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

What is the difference between prokaryotic and eukaryotic cells?

Answers

The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).

The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

Someone please help!!! Anyone!?!? I'll give A Brainliest

Answers

Answer:

These are Punnet squares. The answer for 1 is 50% The answer for 2 is 100%

The answer for 3 is 100%

Explanation:

I hope this helps!! Have a great day!!!

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

Other Questions
A golf ball flies through the air after being struck with a golf club. Which of the following statements describes the force on the ball as momentum is transferred between the club and ball?A. The ball does not experience any force.B. The force experienced by the ball is greater than the force experienced by the club.C. The force experienced by the ball equals the force experienced by the club.D. The force experienced by the ball is weaker than the force experienced by the club. Which of the following would exclude (not allow) a person from being eligible to represent Californiain the U.S. Senate?(A) Being born in England(B) Living in California, but working in Arizona(C) Being 34 years old(D) Having been a citizen for eight years What is the perimeter of JKL? 6 9.5 11.5 19 Which loop prints the numbers 1, 2...100?c = 1while (c Who ever can answer this for me will get a brainly!! Do 10. A student drew the picture of a human body system shown below. The studentlabeled some of the organs of the system.sense odors in the environmentOexchange gases with the environment0chew food as it enters the mouthotrap particles that enter the noseThe main function of this human body system is to -CLEAR ALLUnanswered< PREVIOUS10O 12O 13 O 14NEXTREINTL What is 1.452 rounded to the nearest hundredth 1. Solve the system of equations.2y - 3z=0x+3y = -43x + 4y = 3 find the quotient 8 divided by 1/7. Please answer correctly !!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!! Which pair of triangles MUST be similar? A. Triangle 5 has a 25 degree angle and a 75 degree angle. Triangle 6 has a 25 degree angle and a 70 degree angle. B. Triangles 1 and 2 each have a 40 degree angle.C. Triangle 7 has a 40 degree angle and a 35 degree angle. Triangle 8 has a 40 degree angle and a 105 degree angle. D.Triangles 3 and 4 are both scalene. Each have a 65 degree angle. Maine has a cold climate in the winter. Which statement about the probability of temperatures falling below 32F in Maine during the month of January is most likely true? Options: The probability is 100 | The probability is closer to 1 than to 0. The probability cannot be determined before Febuary The probability could be -1. X: -3, 2, 7, 12Y: 0, 2, 4, 6Whats the slope ? GHB, ketamine, and rohypnol are considered these types of drugsStimulantsNarcoticsDepressantsHallucinogens Argumentative Texts 8:Question 5Which statement does not represent an example of gender bias?Select one:A. In 2004, American men were more dedicated to their work than American womenwere.B. American women are better softball players than American men are.C.In 2004. American women earned more college degrees than American men earned.D.American men are better auto mechanics than American women are. In which cellular organelle is genetic information (DNA) held?A. MitochondriaB. RibosomesC. Cell membraneD. Nucleus Why should youth limit their consumption of added sugars Ocean water is-A. mixtureB. compoundC. elementD. fresh water Autumn spent $32 of the $50 in her wallet. Which decimal represents the fraction of the $50 Autumn spent? please answer soon it's midnight and i need sleep wich inequality is true?