The movie theater sold 538tickets on Friday. On Saturday 907 tickets were sold how many more tickets were sold on Saturday

Answers

Answer 1

Answer:

369 more tickets

Step-by-step explanation:

907-538=369


Related Questions

What is the equation of the line shown in the graph?​

Answers

Answer:

y=4x-3

Step-by-step explanation:

We're given that the equation is linear (a line), so it must be in the form y=mx+b. We're also given that it contains the points (0,-3) and (1,1).

Plugging the values of the x and y coordinates in that first point, we get the equation -3=m*0+b, simplifying to -3=b. Therefore, the b-value is -3.

Next, we can plug in the values from the second point to get the equation 1=m*1-3, which simplifies to 1=m-3. Adding 3 to both sides, we get m=4. Therefore, the equation of the line is y=4x-3.

Note that -3 is the value where the line intercepts the y-axis, which means -3 is known as the y-intercept. The value of b is always the y-intercept.

Question 1 need help asap

Answers

Answer:

x= -9

Step-by-step explanation:

Hope you got this interesting problem!

Answer:

x= x-81

take 180-(x+45)-45= x-81

When you’re multiplying or dividing same sign numbers, what will your product or quotient be?

Answers

When you multiply two integers with the same signs, the result is always positive. Just multiply the absolute values and make the answer positive. When you multiply two integers with different signs, the result is always negative.

The answer will be the opposite of the sign so for example -5*-5= 25

Plz help I’m getting timed

Answers

Answer:

38

Step-by-step explanation:

Answer:

38

Step-by-step explanation:

1-4 round down 5-10 round up

1/2 x = 14
What is x

Answers

Answer:28

Source:trust me bro

Answer:

1/2 x 28 =14       X=28

Step-by-step explanation:

Skye ran rlaps today at soccer practice. Nadine ran five fewer laps than Skye. If Nadine ran eight laps at practice, which of the following equations could be used to find how many laps Skye ran?
r-5= 8
r+5 = 8
r=8-5
-5r=8

Answers

Answer:

A. r - 5 = 8

Step-by-step explanation:

If Nadine ran 5 fewer laps than Skye, and Nadine ran eight laps, "r" equals 13.

Plz help it is over due

Answers

Answer:

32/9

Step-by-step explanation:

(4/1) (9/8)=

32/9

Please help ASAP....A Donut shop sells donuts for $0.75 each with a charge of $1.50 for the box. Write a rule in function notation for this situation.
Options is the mage​

Answers

The answer is the first option.

Please help i will mark brainliest which helps gain ranks

Answers

Answer:

It is proportional

Step-by-step explanation:

The pool is being filled at a constant rate.

Which expression is equivalent to
8(3x+4w)

Answers

Answer:

24x+32w

Step-by-step explanation:

24x+32w is the answer I think

Whenever I post a question nobody answer but when I put freebie everyone starts getting them in the second I post it like really-_-

Answers

Same tbh :( it sucks

Points (-2, 4) and (-1, 1) lie on the same line. Which of the following equations represents the line

Answers

Answer:

y = -3x - 2

Step-by-step explanation:

Given the coordinates  (-2, 4) and (-1, 1), we are to find the equation of a line passing through the points.

The standard form of the equation is expressed as;

y = mx+c

m is the slope

m = y2-y1/x2-x1

m = 1-4/-1+2

m = -3/1

m = -3

get the y-intercept c;

Substitute m = -3 and any point say (-1,1) into the equation y = mx+c

1 = -3(-1) + c

1 = 3 + c

c = 1-3

c = -2

Get the required equation;

y = mx+c

y = -3x + (-2)

y = -3x - 2

The vertices of are F(2,1), G(4,1), and H(4,-1). The vertices of the image of the triangle after a dilation centered at (0,0) are F'(4,2), G'(8,2), and H'(8,-2). What is the scale factor of the dilation?

Answers

Answer:

The scale factor of the dilation is 2

Step-by-step explanation:

The given vertices the ΔFGH are;

F(2, 1), G(4, 1), and H(4, -1)

The lengths of the sides of the triangle ΔFGH are;

The length of segment FG = √((4 - 2)² + (1 - 1)²) = 2

The length of segment FH = √((4 - 2)² + ((-1) - 1)²) = 2·√2

The length of segment GH = √((4 - 4)² + ((-1) - 1)²) = 2

After a dilation with the center of dilation = (0, 0), to give the ΔF'G'H', we have;

The given vertices the ΔF'G'H' are F'(4, 2), G'(8, 2), H'(8, -2)

The length of segment F'G' = √((8 - 4)² + (2 - 2)²) = 4

The length of segment F'H' = √((8 - 4)² + ((-2) - 2)²) = 4·√2

The length of segment G'H' = √((8 - 8)² + ((-2) - 2)²) = 4

The length of the sides of ΔFGH = 1/2 × The length of the sides of ΔF'G'H' or the length of the sides of ΔF'G'H' = 2 × The length of the sides of ΔFGH

Therefore, the scale factor of the dilation is 2.

The earth spins 360 degrees about its axis in 24h. How many degrees does it spin in 10h?

Answers

Answer:

150

Step-by-step explanation:

To figure out how far it turns in one hour divide 360 and 24= 15, now to find out how much it turns in 10 hours multiply 10x15=150

What is the answer please hurry

Answers

Answer:

I dunno

Step-by-step explanation:

Solve the system of equations by graphing. y= -2x + 1

Answers

Answer:

y= -2x + 1

Step-by-step explanation:

Plz help Me on this question

Answers

Answer:

what is it

Step-by-step explanation:

Answer:

Naruto

Step-by-step explanation:

Uzmaki

What is the answer for the equation (2+3x)4

Answers

Answer:

8+12x

Step-by-step explanation:

Answer:

8+12x

Step-by-step explanation:

Evaluate the question and simplify

Answers

The answer is 11.

Step-by-step explanation:

19-25\19-15

44/4= 11

10 POINTS!!!! for the most meaningful message along with a Brainliest

Answers

Answer:

If you always give without thinking of receiving something, you will get more than you need later.

-lorraine9fig

Step-by-step explanation:

Yes. I used my own quote.

"Challenges are what make life interesting and overcoming them is what makes life interesting"

-Joshua J. Marine

"Don’t Let Yesterday Take Up Too Much Of Today."

-Will Rogers

“You Learn More From Failure Than From Success. Don’t Let It Stop You. Failure Builds Character.”

– Unknown

“It’s Not Whether You Get Knocked Down, It’s Whether You Get Up.”

–Vince Lombardi

“Failure Will Never Overtake Me If My Determination To Succeed Is Strong Enough.”

– Og Mandino

“We May Encounter Many Defeats But We Must Not Be Defeated.”

– Maya Angelou

“The Only Limit To Our Realization Of Tomorrow Will Be Our Doubts Of Today.”

– Franklin D. Roosevelt

Please help me please!!!

Answers

Domain : 4 ,1 ,0
Range : 2 ,1 ,0 ,-1 ,-2

How would knowing the type of symmetry help you graph a function?

Answers

A graph is said to be symmetric about the y -axis if whenever (a,b) is on the graph then so is (−a,b) . Here is a sketch of a graph that is symmetric about the y -axis. A graph is said to be symmetric about the origin if whenever (a,b) is on the graph then so is (−a,−b) .

hope this helped u <3

Answer: How do you describe the symmetry?

If f (-x), then the graph of f(x) is symmetrical with respect to. A function symmetrical with respect to the y-axis is called an even function. A function that is symmetrical with respect to the origin is called an odd function.

Step-by-step explanation: hope I help you with your problems

john swims 5/12 of a mile in 3/8 of an hour. What distance, in miles, does john swims in an hour?

A.) 1 5/9
B.)15/96
C.)5/20
D.)1 5/12​

Answers

Answer:

1 1/9 miles

Step-by-step explanation:

If john swims 5/12 of a mile in 3/8 of an hour, then;

5/12 miles = 3/8 hours

TO get the number of miles he swims in an hour, we will say;

x miles = 1 hour

Equating both expressions

5/12 miles = 3/8 hours

x miles = 1 hour

Cross multiply

3/8 x = 5/12

3x/8 = 5/12

3x * 12 = 5 * 8

36x = 40

x = 40/36

x = 10/9

x = 1 1/9

The amount he swims in an hour is 1 1/9 miles

convert
27/8
41/18
41/15
and 29/12
into Mixed numbers show steps please

Answers

Answer:

Ok

Step-by-step explanation:

27/8 = 3 3/8

41/18 = 2 5/18

41/15 = 2 11/15

29/12 = 2 1/3

) Kelli and her family went to the beach for vacation. They drove 293 miles in 7 hours to get there. If they drove the same number of miles each hour, about how many miles did they drive each hour? Select the numbers the quotient is between. *

Answers

Answer:

about 42 miles rounding up

Step-by-step explanation:

293÷7 and round up

What is the lcm of 11 and 14

Answers

Answer:

154

Step-by-step explanation:

MARKIGN PEOPLE AS BRIANLIST NEED HELP THANK YOU

Answers

Answer:

B. I think, im not in this level yet

Step-by-step explanation:

The two right triangles on the graph below are similar.

Answers

Answer:

B is the correct chose

Step-by-step explanation:

which of the following if rational( )
a)
[tex]\pi[/tex]
b)log2 c)1.23123... d)none ​

Answers

If c is repeating the the answer is none

Hii can someone help me this is science I didn’t mean to put math and this is 6th grade work btw I’ll give you BRAINLIST if you want one no joke ! Please answer does 2 questions

Answers

Answer:

Lunar, and solar eclipse!

Step-by-step explanation:

This first one, is pretty easy! An easy way to remember it is solar is sun (both start with s), so lunar is moon!

The second one is solar eclipse, since the moon passes between the sun and earth, which causes the moon's shadow to fall on earth!

I hope this helps, and I'm here if you need anything else! <3

Other Questions
What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, The scale on a map says that 4 cm represents 5 km. What distance on the map (in centimeters) represents an actual distance of 4 km? A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? What are some real-life situations that require a program that is iterative? Include at least three examples in your answer. Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope.