Answer:
energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.
Explanation:
Hope this helps :)
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
A molecule of oxygen gas contains two:
O molecules
O elements
O atoms
Answer:
O atoms
Explanation:
:)))
A molecule of oxygen gas contains two atoms of oxygen bonded together.
Answer: your answer will be C
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
What are the advantages and disadvantages of a honey bees sexual reproduction
Answer:I just learned this.
Explanation: The Advantage is that they have plant pollination and honey.
⦁ In what stage of an animal’s life cycle do most cells differentiate?
Answer:
Reproduction
Explanation:
Answer:
Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.
What are 3 lines of evidence that corroborate the theory of evolution?
Answer:
Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.
Explanation:
I majored in Biology
which layer of the earth is made out of melted metal?
The outer core. A molten nickle- iron alloy.
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
What biotic factors might affect a population of fish? Check ALL that apply.
predators
prey
light
bacteria
Answer:
Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.
Explanation:
Are gender traits completely a result of societal expectations?
Answer:
No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
how do vital signs allow medical professionals to assess a patient's physiology and overall health
they measure the pulse rate and blood pressure of a patient, these can help to determine if a patient has any diseases of the blood or if they are under stress.
A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.
Answer:
Photon, light dependent reaction of photosynthesis
Explanation:
Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.
There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.
In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.
Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".
How does the size of a bacterial cell compare with an animal cell?
Answer:
hope it helped
Explanation:
Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.
correct order of events during the process of nucleosynthesis?
Answer:
hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed
Explanation:
Answer:
A
Explanation:
took the quiz
what is reduced soil?
Answer:
A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.
PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.
Thank You so Much
your amazing have a great life
1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me
Answer:
"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."
Explanation:
Hope this helps :)
When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:
A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.
Answer:
A
Explanation:
the northern hemisphere is the opposite from the southern hemisphere
Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.
Why are the seasons reversed in each hemisphere?The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.
Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.
Learn more about seasons, here:
https://brainly.com/question/12028829
#SPJ2
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.
Answer:
the hard work he went through
How could one determine if two
unidentified organisms share a common
ancestor?
Answer:
Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.
Explanation:
DNA
They can look at the DNA it's the most common one.
There are 4 pieces of evolution and they are
Fossils , Geography , Embryos / DNA , Anatomy
Fossils: Physical remains of species , Determine age, location, environment
Deeper layers = older
Geography: Proves species share common ancestors, depending on where
they live
DNA: BEST evidence because it’s the MOST ACCURATE
Similarities in the early stages of development
Similarities in DNA
More similarities = closely related
More differences = not related
Anatomy: Compare body parts of different species to see how they evolved
3 different structures:
Homologous (same structure, different function)
Analogous (similar structure, different organisms)
Vestigial (body parts that no longer serve a purpose)
All of that are in evolution
Hope it helped! ( Gave u my biology notes :D)
how does the respiratory and digestive system work together to maintain homeostasis
The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.
HOPE IT HLPS UH WELL✌✌What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]
When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.
The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons
Answer: transfer of electrons
Explanation:
When is carbon dioxide released during aerobic cellular respiration?
Answer:
I hope this helps and rate it if its right
Explanation:
I hope this helps and rate it if its right
please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?
Answer:
A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.