The division of the cytoplasm, which follows Mitosis, is called...

Answers

Answer 1

Answer:

Cytokinesis,

Explanation:

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

Answer 2

The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.

What is Mitosis?

Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.

In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.

Read more about Cell

https://brainly.com/question/2622341

#SPJ2


Related Questions

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

Which statement is part of the cell theory?
A Single-celled organisms are made of one cell.
B Cells are different in size and shape.
C All cells come from other living cells.
D Cells sometimes only have one job.

Answers

Answer:

I believe it's C, all cells come from other living cells.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!


Which is not a likely economic tool to address environmental issues?
Emissions fees and taxes

Responsibility for a product from production to disposal

Small business liability relief

Defunding government regulation

Answers

Explanation:

Policy-makers have two broad types of instruments available for changing consumption and production habits in society. They can use traditional regulatory approaches (sometimes referred to as command-and-control approaches) that set specific standards across polluters, or they can use economic incentive or market-based policies that rely on market forces to correct for producer and consumer behavior. Incentives are extensively discussed in several EPA reports

Two basic types of traditional regulatory approaches exist. The first, a technology or design standard, mandates specific control technologies or production processes that polluters must use to meet an emissions standard. The second, a performance-based standard, also requires that polluters meet an emissions standard, but allows the polluters to choose any available method to meet that standard. Performance-based standards that are technology-based, for example, do not specify a particular technology, but rather consider what available and affordable technologies can achieve when establishing a limit on emissions. At times, EPA may completely ban or phase out the use or production of a particular product or pollutant, as it has done with chlorofluorocarbons (CFCs) and certain pesticides. Regulations can be uniform or can vary according to size of the polluting entity, production processes, or similar factors. Regulations are often tailored in this manner so that similar regulated entities are treated equally. MARK AS BRAINLIEST IF IT HELPS

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^

Look at the graph below. A graph is shown with Absolute magnitude shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4. Which of the following stars is most likely to be red? Star A Star B Star C Star D

Answers

Answer:

Star A

Explanation:

If you look directly at the diagram, the dwarf stars are labeled under 'A' and are the least in mass and temperature.

Being the smallest and coldest, dwarf stars most commonly have red coloration, which would make them the obvious choice.

Star A which is a dwarf star has the coldest temperature, and therefore is a red star since red stars are the coldest stars.

What are stars?

Stars are a large self-luminous bodies whichbpriducw large amounts of heat energy and light energy as a result of the nuclear reactions occurring within them.

Stars have different colors and different sizes.

Red stars are the coldest stars and also the least massive.

From the chart, Star A which is a dwarf star has the coldest temperature, and therefore is a red star.

Learn more about red stars at: https://brainly.com/question/11562269

#SPJ2

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

If a cell suddenly stopped producing transfer RNA, which of the following processes would be immediately affected?

Answers

Answer: DNA

Explanation: The RNA is a big affect on the DNA because, there will be no repairs of the DNA leading to cancer

What changes occur to the ratio of surface area to volume as a cell
grows?

Answers

Answer:

As a cell grows, its surface area-to-volume ratio decreases

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes

What appearance is liquid and gas? Choose all that apply.
A: Flows
B: Rigid
C: Stays at bottom of the container
D: Holds it's shape
E: Fills container
F: Takes shape of container
G: No visible shape

Answers

Answer:

2 shows the differences among solids, liquids, and gases at the molecular level. A solid has definite volume and shape, a liquid has a definite volume but no definite shape, and a gas has neither a definite volume nor shape

Explanation:

What environment does ambulocetus live in?

Answers

Answer:

northern Pakistan, in long-lost coastal shallow seas and brackish rivers

Explanation:

i'm hoping this is right

how do you think the idea of sustainability influences the work of foresters?



help me

Answers

It’s funny because the concept of sustainability is thought to come from field of forestry. Around the year 1700, Carl von Carlowitz described the concept of sustainable forestry.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

If the cell cycle lasts 36 hours and mitosis takes 25% of the cell cycle, how many hours will the cell be in mitosis?

Answers

mitotic index I = (P+M+A+T)/ TOTAL cell, N) *100 %
(P+M+A+T) — the sum of all cells in phase as prophase, metaphase, anaphase and telophase, respectively; N — total number of cells.
Mitototic index (MI) is 3/25000 x 100 = 1.2 %
From the cell cycle, 1.2% is mitotic and the rest will obviously be interphase.
So, 1.2% is 30 minutes, so 100% (length of total cell cyle) is 2500 minutes (42hours).




I hope this helped you.

What is the difference between a molecule and a diagram of a molecule ?

Answers

Answer: The molecule itself is the actual thing present.

while the diagram explains what makes up a molecule or what it looks like structurally

Explanation:

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

When you step
on a scale, what is being
measured?

Answers

Answer:

Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.

Explanation:

What the person above me said is correct


Explanation it’s correct I’m positive

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

Other Questions
Will give Brainliest to best answer! Which of the following statements about citizens is FALSE?A.Citizens are members of a country.B.Citizens share common history, values, and traditions.C.Citizens are no longer considered citizens of their original country if they live abroad.D.Citizens agree to follow laws and honor the authority of their government. Which two properties characterize an air mass? Which statements describe density? Check all that apply. A. Density is a chemical property of an object. B. The density of an object is constant. C. Density is a derived unit of measure. D. Density is the sum of the mass and volume of an object. E. The density of an object determines whether it will sink or float. Find X. Math its.com Why did the British Parliament impose (make them pay) taxes on the colonists after 1763? Question 1 options:to pay for King George's lavish lifestyleto pay off the debts from the French and Indian Warto pay for a new building for Parliamentto pay the French to keep out of American affairs Which of the following expressions is equal to 5 - 2m?7 - 2(m + 1)7 - (2m - 5)7 - 2(m - 2) divide 4,052 divided by 61 What type of noun is the word shore in the following sentence?Go down the highway until you reach the shore.proper nouncompound nounsimple noun Solve the equation by graphing. - x2 = 8x + 20 Translate it to proper Spanish, please. I request don't use the translator, please! I beg no translator.The weather had been so warm in recent days, the air so velvety on the skin. It was a spa from the time the light filtered over the hills until it too took its rest. Clouds drifted by on the most relaxed of breezes, helping our eyes to appreciate the bluebird sky all the more. The rain, when it came, alighted as softly as the shoes of a ballet dancer, adorning and rejuvenating the only stage that mattered. Pls help I give u 50 points Cause and Effect How did early labor organizations affect working conditions for their members? The perimeter of a rectangle is 70cm. if its length is decreased by 5cm and its width is increased by 5cm, its area will increase by 50 cm^2. Find the length and the width of the original rectangle. Why is Queen Victoria called Europes grandmother? Refer to Explorations in Literature for a complete version of this story.How do Rainsford's complex traits advance the plot of "The Most Dangerous Game"?Select each correct answer.His cleverness leads him to realize that he should kill Ivan.His superb skill at hunting enables him to outwit Zaroff.In the end, his wisdom leads him to admit that animals do have feelings.On the ship, his curiosity leads him to fall overboard. You are going to read an article about the Vikings. Choose the most suitable heading from the list A-F for each part (1-5) of the article. There is one extra heading you do not have to use.A. Informative monumentsB. Heroic deedsC. Scientific proofD. Scarce informationE. A different way to informF. Negative characteristics1____________The Vikings have left many traces of their settlement which are still visible today. Archaeology provides physical evidence of their conquests, settlement and daily life. The study of place-names and language shows the lasting effect which the Viking settlements had in the British Isles, and DNA analysis provides some insights into the effect the Vikings had on the genetic stock of the countries where they settled. All of this provides valuable information, but the only reason that we have an idea of the 'Vikings' as a people is their appearance in the written sources.2___________Unfortunately, the value of the written evidence is limited. Not a lot of evidence survives, and much of what we have is either uninformative or unreliable. Many popular ideas about Vikings are nineteenth-century inventions. Others are the result of early historians accepting sources which modern scholars now regard as completely unreliable. In Scandinavia the Viking Age is regarded as part of prehistory because there are practically no contemporary written sources. Even in western Europe, the Viking Age is often seen as part of the 'Dark Ages', from which comparatively few historical records have survived.3__________Surviving accounts of Viking activity were almost exclusively written by churchmen. These include monastic chronicles, such as the Anglo-Saxon Chronicle and similar Frankish and Irish Annals, which outline broadly what happened, at what date. There are also sources of a more directly religious nature, such as the much-quoted letters of Alcuin, and Wulfstan's famous 'Sermon of the Wolf', both of which chose to interpret the Viking raids as God's punishment on the Anglo-Saxons for their sins. Even the chronicles reflect the fact that the Vikings often attacked monasteries for their wealth, which created an obvious bias against them, and the hostile tone of these contemporary accounts has done much to create the popular image of Viking atrocities. However, modern historians have noted that the same sources show Christian rulers behaving equally unpleasantly, but without being condemned on religious grounds.4_________One of the reasons that we have so few records from the Viking Age is that the Vikings did not become familiar with the Roman alphabet (the alphabet we use today) until they adopted Christianity. However, they did have another form of lettering, known as runes. Runes were normally carved, rather than written, and were therefore mostly used for fairly short inscriptions. It is unknown how many people could read runes in the Viking Age. Runic inscriptions on pieces of wood from Bergen in Norway show that runes were used for all sorts of everyday purposes later in the Middle Ages, but no comparable evidence has survived from the Viking Age, and it is likely that few people were literate in runes. However, the fact that some Vikings were able to carve their names on their possessions suggests that the use of runes wasn't uncommon.5____________Most of the surviving runes are found on large memorial stones. Very often they only have the name of the person in whose memory the stone was carved, and the names of those responsible for having it made. Sometimes the name of the rune-carver was also given. Occasionally the inscriptions describe the achievements of the person commemorated, and refer to historical events in which they were involved. For this reason, runic inscriptions are a valuable source for Viking history. However, because they are so brief, they never give a very full picture, and often raise as many questions as they answer. How does the section "The end of the tongue map contribute to the development of ideas in the text (Paragraphs 6-)A It shows that there was false information about the tongue for a long timeB. It shows that no two people have the same taste receptors on their tongueIt shows that most people don't believe that all part of the tongue can tasteD. Te shows that some people only have taste receptors on certain parts of their tongue answer pleaseesesese What is the square root of 100? In I Have a Dream, what evidence does Martin Luther King, Jr. give for the claim that America has failed to deliver to black people on the promises in the Constitution and Declaration of Independence?