Answer:a mountain range
Explanation: because when when they crashed it created a mountain range
Answer:
B
when they crashed it created a mountain range
Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment
Answer:
C. An irregularly shaped sediment
Explanation:
Deposition is the settling of sediments within respective basins of deposition.
Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.
As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.
A. A high density sediment and a large sediment will have a fast settling time.
B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.
Answer:
the answer is C. an irregulary shaped sediment
Explanation:
hope this helps!
Use the following questions to write your conclusion to your lab report.
What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)
How could you make the lab better?
Answer:
WHat??
Explanation:
what are cork tissues? how are they formed?
Answer:
Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.
Explanation:
True Or False urgebt
Answer:
The answer is true
Explanation:
true
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answer:
TAA ATT GAC AAG ACA GAT CTC
1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.
2. codon
three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).
3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.
OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)
3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.
What is a nucleotide sequence?A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.
Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.
Learn more about nucleotide sequence, here:
https://brainly.com/question/30299889
#SPJ6
What makes each of the mechanical layers different?
A. Whether the layer is rock or metal
B. Whether the layer is solid, liquid, or in between
C. Whether the layer is dense or thick
whitch of the following nutrients is primarily used for building and repairing of demaged cells and tissues
Answer: protein ..i hope this helped!
Explanation: protein is a nutrient used to make and repair our body cells like blood and muscle cells.
Answer:
Explanation:
he is correct
Scientists are studying the bacteria living in termites because they want to
genetically engineer......
Bacteria that can resist pests on crops.
Bacteria that can create ethanol from left over plant material.
Bacteria that create a vaccine.
Bacteria that create antibiotics.
Answer:
B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)
Bacteria that can resist pests on crops.
The following information should be considered:
In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.Learn more: https://brainly.com/question/5303391?referrer=searchResults
Will give brainliest
Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B.
After asking her mother, she finds out that her mother's blood type is A. However, her father cannot remember his blood type.
Which of the following blood types could her father have?
I. A
II. B
III. AB
IV. O
A.
I or III only
B.
I, II, or IV only
C.
I, II, III, or IV
D.
II or III only
Answer:
C. I, II, III, or IV
Explanation:
I got it right on study island
Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B. In such case her father may have blood type A,B, AB, and O. Thus, option C is correct.
What is blood group?The three alleles that are A, B, and O are mainly responsible for controlling the major blood groups such as A, B, and AB, respectively. Due to this fact that humans are considered as diploid, each genotype could only include the maximum of two of them. Just to put it another way, just only two of these alleles could coexist in the single cell of the human at given time.
IA, IB, and I are considered as the three distinct alleles that could determine the person's blood type. I has been considered as the most common. These three alleles could be referred to as the A (for IA), B (for IB), and O for the sake of simplicity (for i). Because we receive one blood type allele from our biological mother and one from our biological father, each of us has two ABO blood type alleles.
Therefore, option C is correct.
Learn more about blood on:
https://brainly.com/question/14781793
#SPJ3
can someone pleasee answer thiiisss pleasee
Answer:
Hi how are you doing today Jasmine
How will water volume, incline gradient, and temperature affect the energy
of a stream?
Answer: Water Volume: The volume of water(discharge) in a stream affects the energy(velocity) of that stream. As the volume of the water in the stream increases, the velocity increases. ... Incline gradient: The incline gradient is also known as the slope of the stream.
Explanation:
Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it
Answer: aragonite oyster shell crab meal
Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals
Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level.
A. equalizes
B.does not change
C. decreases
D. increases
Answer:
D - Methyl Mercury Increases
Explanation:
The word Biomagnification has a simple explanation:
To magnify is to make bigger, meaning that the substance in question is becoming more abundant.
The "bio" part of this word is referring to the fact that it is a biological substance you are dealing with.
Question: "Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level."
Answer: "The concentration of the methylmercury increases as it moves through each higher trophic level. Hence, the methylmercury biomagnifies in the ecosystem. So, based on the options given prior to the question above, Option D) increases would be your best bet."
if the atmosphere is 21% oxygen and the cornea contains 15% oxygen, which direction will more of the oxygen molecules travel: into the cornea or out of the cornea
A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet
Answer:
The answer is D, patient's diet.
Explanation:
As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.
Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.
How is gigantism diagnosed?If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.
Thus it is clear that medical books will have a medical history of patetint wityh gigantism.
To learn more about gigantism refer to the link :
https://brainly.com/question/7035609
List and explain the 3 paths natural selection can take.
Answer:
1. Stabilizing Selection
2. Directional Selection
3. Disruptive Selection
Explanation:
Stabilizing Selection
This type of natural selection occurs when there are selective pressures working against two extremes of a trait and therefore the intermediate or “middle” trait is selected for. If we look at a distribution of traits in the population, it is noticeable that a standard distribution is followed:
Example: For a plant, the plants that are very tall are exposed to more wind and are at risk of being blown over. The plants that are very short fail to get enough sunlight to prosper. Therefore, the plants that are a middle height between the two get both enough sunlight and protection from the wind.
Directional Selection
This type of natural selection occurs when selective pressures are working in favour of one extreme of a trait. Therefore when looking at a distribution of traits in a population, a graph tends to lean more to one side:
Example: Giraffes with the longest necks are able to reach more leaves to each. Selective pressures will work in the advantage of the longer neck giraffes and therefore the distribution of the trait within the population will shift towards the longer neck trait.
Disruptive Selection
This type of natural selection occurs when selective pressures are working in favour of the two extremes and against the intermediate trait. This type of selection is not as common. When looking at a trait distribution, there are two higher peaks on both ends with a minimum in the middle as such:
Example: An area that has black, white and grey bunnies contains both black and white rocks. Both the traits for white and black will be favored by natural selection since they both prove useful for camouflage. The intermediate trait of grey does not prove as useful and therefore selective pressures act against the trait.
I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )
Answer:
A is the correct answer.
Second part:
17. What are gremline cells
18. How is mitosis different from meiosis?
Answer:
just see explainnation
Explanation:
what is gremline cells tell me and the teach me what is mitisis ok and then teach me meiosis ok the I will tell u answer of thes question
Make a list of the energy carriers involved in the Krebs cycle. Include their names before and after they accept the electrons.
Thank you!
Answer:
12
Explanation:
Describe a DNA molecule and its shape
Answer:
DNA is a long molecule, made up of two strands twisted together to make a spiral known as a double helix.
I was wondering if my answer was right ?
Explanation:
yes the 4th one is right so yes the one you have is right
Identify part A, B and C. What is the function of part B?
What is the meaning of life? (I’m Giving out 35 points)
Answer: do what makes you happy
Explanation:
Answer:
to live life to the fullest and appreciate the little things that make you happy and follow your dreams and just accept all the bad days because life isn't perfect and neither is everyone
Which of the following is true about moss sporophytes?
a. Sporophytes perform photosynthesis. C. Sporophyttes contain a single spore.
b. Sporophytes depend on the gametophyte for d. Sporophytes are very large.
nutrients.
Answer: sporophytes photosynthesise, particularly when immature, but depend on gametophytes for at least 50% of nutrient requirements
Explanation: In mosses, the gametophyte generation is the dominant generation unlike in higher plants. The diploid sporophyte generation produces several spores per capsule.
Answer:
c
Explanation:
FILL IN THE BLANK!!!
genotype is the____pair of alleles (TT)____of an organism. And phenotype is the____apperence__of an organism
Answer:
THIS IS IT
Explanation:
The genetic makeup of an organism (ex: TT). Phenotype, The physical ... from each parent). This pair of alleles is called a genotype and determines the organism's appearance, or phenotype. ... A Punnett square can be used to predict genotype and phenotypes of offspring from genetic crosses
What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
The option (B) is the relationship between a protein, the cell, and DNA.
Which statement describes an interaction between the biosphere and the atmosphere that is related to
photosynthesis?
O During photosynthesis, plant roots take in water from soil.
O During photosynthesis, plants take in carbon dioxide from the air.
O Through photosynthesis, energy stored in plants is released into the air.
O Through photosynthesis, energy stored in plants is transferred to humans who eat them.
Answer:During photosynthesis, plant roots take in water from soil.
Explanation:
Answer:
During photosynthesis, plants take in carbon dioxide from the air.
Explanation:
The second answer is correct because it includes an interaction between the atmosphere and the biosphere.
What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below
The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.
What is asthenosphere?The asthenosphere is the upper mantle's mechanically sluggish and ductile region.
It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.
Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.
The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.
The "plastic" essence of the asthenosphere is caused by heat from below.
Thus, the correct option is D.
For more details regarding asthenosphere, visit:
https://brainly.com/question/7152935
#SPJ2
Where will you find permafrost? tall grass prairie savanna chaparral tundra
Answer:
Where Is Permafrost Found? About a quarter of the entire northern hemisphere is permafrost, where the ground is frozen year-round. It's widespread in the Arctic regions of Siberia, Canada, Greenland, and Alaska—where nearly 85 percent of the state sits atop a layer of permafrost.
Explanation:
hope this helps
a person suffering from cold doesn't get proper test why