The device shows the relative humidity at 22°C. What’s the water vapor density if the maximum water vapor in air at this temperature is 20 grams/cubic meter?
A device showing that at 22 degrees Celsius the relative humidity is 58%.

Answers

Answer 1

Answer:

The answer would be 11.6 g/m^3

Explanation:

Knowing that vapor's density at 100% humidity is 20g/m^3 we can calculate the answer using the following math:

0.58 * 20 = 11.6 grams per cubic meter

the units can also be written as g/m^3

Answer 2

The density of water vapor is 11.6 grams/cubic meter.

What is relative humidity?

The quantity of atmospheric moisture that is present compared to the amount that would be there if the air were saturated is known as relative humidity, and it is stated as a percentage. Relative humidity depends on both moisture content and temperature because the latter quantity is temperature-dependent. The related temperature and dew point for the specified hour are used to calculate relative humidity. it is expresses as %.

Now given that the maximum water vapor in air at this temperature is 20 grams/cubic meter at 22°C, that is, density of vapor at 100% humidity is 20g/[tex]m^3[/tex]  at 22°C.

And, The device showing that at 22 degrees Celsius the relative humidity is 58%

So, water vapor density at that moment is = 20g/[tex]m^3[/tex] × 58%

= 11.6 g/[tex]m^3[/tex] .

= 11.6 grams/cubic meter.

Hence, according to the measurement of device, the water vapor density is 11.6 grams/cubic meter.

Learn more about relative humidity here:

https://brainly.com/question/22069910

#SPJ2


Related Questions

1. A 75.0 kg man pushes on a 500,000kg wall for 250s but it does not move. How
much work does he do on the wall?

Answers

Answer:

0J

Explanation:

No work is being done on the wall by the man pushing on it.

 Given parameters:

Mass of man  = 75kg

Mass of wall  = 500000kg

Time  = 250s

Unknown:

Work done  = ?

Solution:

Work done is the force applied on a body that moves it along a particular path.

For work to be done, distance must be move or displacement must occur.

Since the wall is not moving the distance is 0;

    Work done  = Force x distance

Since distance is 0m, work done is 0J

The work done on the wall by the man is 0 J.

To calculate the amount of work done by the man, we use the formula below.

Formula:

W = (ma)d............. Equation 1

Where:

W = Work done on the wall by the manm = mass of the walla = acceleration of the walld = distance.

from the question,

Given:

m = 500000 kga = 0 m/s² (not moving)d = 0 m.

Substitute these values into equation 1

W = 500000(0)(0)W = 0 J.

Hence, the work done on the wall by the man is 0 J.

Learn more about work done here: https://brainly.com/question/8119756

two cars with initial speed 2v and v, lock their brakes and skid to a stop. what is the ratio of the distance travelled

Answers

Answer:

4:1

Explanation:

Given that the initial speed of the first car, u = 2v while the initial speed of the second car, u = v. To find the distance travelled, we are going to apply one of the equations of motion. The equation chosen is

v² = u² - 2as, where

s = the distance needed

a = acceleration due to gravity

u = initial velocity which is v & 2v

v = final velocity which is 0

For the first car with initial velocity, 2v, on substituting into the equation, we have

v² = u² - 2as(1)

0 = 4v - 2as(1)

4v = 2as(1)

2v = as(1), making s(1) subject of formula we have

s(1) = 2v/a

Taking the second car, we have u = v

v² = u² - 2as(2)

0 = v - 2as(2)

v = 2as(2), making s(2) subject of formula, we have

s(2) = v/2a

Not, ratio of s1 : s2 =

2v/a : v/2a

s1/s2 = 2v/a ÷ v/2a

s1/s2 = 2v/a * 2a/v

s1/s2 = 4av/av

s1/s2 = 4/1

Therefore, the ratio of the first car to the second car is 4:1

Please leave a like if it helped you

What happens to most of the light waves that strike a clear pane of glass? O A. absorption B. diffraction O C. reflection O D. transmission​

Answers

slight reflect but most goes through because glass is transparent

Most of the light waves that strike a clear pane of glass reflects. Details about reflection can be found below.

What is reflection?

Refection in physics is the property of a propagated wave being thrown back from a surface such as a mirror.

Mirror is an example of an object that could be hit by an incumbent wave, however, most of the light waves that hit the mirror surface gets reflected back.

Therefore, most of the light waves that strike a clear pane of glass reflects.

Learn more about refection at: https://brainly.com/question/15487308

#SPJ2

Determine the absolute pressure on the bottom of a swimming pool 30.0 mm by 8.4 mm whose uniform depth is 1.9 mm .

Answers

Answer:

=101343.62N/m^2

Explanation:

absolute pressure on the bottom of a swimming pool= atmospheric pressure +( 2 ×ρ ×g)

( 2 ×ρ ×g)= guage pressure

atmospheric pressure= 101325pa

h= height= 1.9 mm = 1.9×10^-3m

ρ = density of water

= 1000kg/m^3

g= acceleration due to gravity= 9.8m/s^2

Then substitute, we have

absolute pressure on the bottom of a swimming pool= 101325+ [0.0019 ×1000 × 9.8)]

=101343.62N/m^2

Hence, the absolute pressure on the bottom of a swimming pool is =101343.62N/m^2

a ball of diameter 10 cm and mass 10 grams is dropped in a container of water. the cross sectional area of the container is 100 cm2.. what is the change in the height of the water column

Answers

Answer:

h = 9.83 cm

Explanation:

Let's analyze this interesting exercise a bit, let's start by comparing the density of the ball with that of water

       

let's reduce the magnitudes to the SI system

         r = 10 cm = 0.10 m

         m = 10 g = 0.010 kg

         A = 100 cm² = 0.01 m²

the definition of density is

          ρ = m / V

the volume of a sphere

         V = [tex]\frac{4}{3} \ \pi r^{3}[/tex]

          V = [tex]\frac{4}{3}[/tex] π 0.1³

          V = 4.189 10⁻³ m³

let's calculate the density of the ball

           ρ = [tex]\frac{0.010}{4.189 \ 10^{-3} }[/tex]

           ρ = 2.387 kg / m³

the tabulated density of water is

         ρ_water = 997 kg / m³

we can see that the density of the body is less than the density of water. Consequently the body floats in the water, therefore the water level that rises corresponds to the submerged part of the body. Let's write the equilibrium equation

            B - W = 0

            B = W

             

where B is the thrust that is given by Archimedes' principle

           ρ_liquid  g V_submerged = m g

           V_submerged = m / ρ_liquid

we calculate

            V _submerged = 0.10 9.8 / 997

             V_submerged = 9.83 10⁻⁴ m³

The volume increassed of the water container

           V = A h

            h = V / A

let's calculate

            h = 9.83 10⁻⁴ / 0.01

            h = 0.0983  m

this is equal to h = 9.83 cm

which of the following is not a mechanical form of energy?
a. Nuclear
b. Kinetic
c. Spring potential
d. Gravitational potential ​

Answers

Answer:

The answer is Spring Potential

Explanation:

Because all the others are a mechanical form of energy

Q2. You push a crate up a ramp with a force of 10 N. Despite your pushing, the crate slides down the ramp 4 m. How much work did you do

Answers

Answer:

40 J

Explanation:

From the question given above, the following data were obtained:

Force (F) = 10 N

Distance (s) = 4 m

Workdone (Wd) =?

Work done is simply defined as the product of force and distance moved in the direction of the force. Mathematically, we can express the Workdone as:

Workdone = force × distance

Wd = F × s

With the above formula, we can obtain the workdone as follow:

Force (F) = 10 N

Distance (s) = 4 m

Workdone (Wd) =?

Wd = F × s

Wd = 10 × 4

Wd = 40 J

Thus, 40 J of work was done.


Define friction. Prove that tangent of angle of friction is equal to coefficient
of friction.​

Answers

Answer:

Friction is the force that opposes movement between moving objects.

The angle at which one object starts to slip on the other is directly related to the coefficient. When the two objects are horizontal there is no frictional force. So, the coefficient of static friction is equal to the tangent of the angle at which the objects slide. A similar method can be used to measure μk.

Explanation:

Answer:

brainliest plsssssss

Explanation:

The resistance that one surface or object encounters when moving over another

Question 3 (1 point)
here were 2cars racing a quarter mile. The green car had a mass of 1200kg and crossed the finish line with a velocity of 53m/s. The red car had
a mass of 1100Kg and crossed the finish line with a velocity of 55m/s.,Which car had the great momentum?

Black car
Blue car
Green car
Red car

Answers

Answer:

The green car had the greatest momentum

Explanation:

Momentum

Momentum can be defined as "mass in motion" and is calculated as the product of the mass of the object by its velocity.

Being v the magnitude of the velocity and m the mass of the object, the momentum is calculated with:

p = mv

The green car had a mass of m1=1200 kg and crossed the finish line at v1=53 m/s. Hence, its momentum was:

p1 = 1200 Kg * 53 m/s = 63600 Kg.m/s

The red car had a mass of m2=1100 kg and crossed the finish line at v2=55 m/s. Hence, its momentum was:

p2 = 1100 Kg * 55 m/s = 60500 Kg.m/s

Since p1 > p2, then the green car had the greatest momentum

Optimus Prime is flying straight up at 24 m/s when he accidentally drops his mega-ray blaster and it falls 94 m to the ground below. Calculate how long it takes for his mega-ray blaster to hit the ground.

Answers

Answer:

The time it will take the mega-ray blaster to hit the ground is 2.57 s.

Explanation:

Given;

initial velocity of Optimus Prime, u = 24 m/s

height of fall of the mega-ray blaster, h = 94 m

The time of fall of the mega-ray blaster is calculated using the following kinematic equation;

[tex]h = ut + \frac{1}{2}gt^2\\\\94 = 24t + \frac{1}{2}(9.8)t^2\\\\94 = 24t + 4.9t^2\\\\4.9t^2 +24t -94 = 0\\\\Use \ formula \ method \ to \ solve \ for \ "t"\\\\a = 4.9 , b = 24, c = -94\\\\t = \frac{-b \ +/- \ \sqrt{b^2 -4ac} }{2a} \\\\t = \frac{-24 \ +/- \ \sqrt{(24)^2 -4(-94 \times4.9)} }{2(4.9)} \\\\t = \frac{-24 \ +/- \ \sqrt{2418.4} }{9.8}\\\\t = \frac{-24 \ +/- \ 49.177 }{9.8}\\\\t = \frac{-24 \ +\ 49.177 }{9.8} \ \ or \ \ t = \frac{-24 \ -\ 49.177 }{9.8} \\\\[/tex]

[tex]t = 2.57 \ s \ \ or \ \ t = -7.47 \ s[/tex]

t = 2.57 s

Therefore, the time it will take the mega-ray blaster to hit the ground is 2.57 s.

If the angle between two forces increases, the magnitude of their resultant-
A Decreases
C. Remain unchanged
D. Decrease than decreases​

Answers

A is the answer to your question

The least count of stopwatch is 0.2s.The time of 20 oscillations of a pendulum was measured to be 25s.Find the percentage error in the measurement of time​

Answers

Answer:

0.8%

Explanation:

We are given;

Number of oscillations; n = 20

Time taken; t = 25 s

Formula for period of oscillation;

T = t/n = 25/20 = 1.25 s

We are told that the least count is 0.2 s. Thus, error is; ΔT = 0.2 s

percentage error in the measurement of time is given by;

(0.2/(20 × 1.25)) × 100% = 0.8%

An automobile which set the world record for acceleration increase speed from rest to 96 km/h in 3.07 seconds what distance traveled by the time the final speed was achieved

Answers

Answer:

41.02m

Explanation:

Given parameters:

Initial velocity = 0m/s

Final velocity  = 96km/hr

Time taken  = 3.07s

Unknown:

Distance traveled by the time the final speed was achieved = ?

Solution:

To solve this problem, we first find the acceleration of the car;

     Acceleration  = [tex]\frac{v - u }{t}[/tex]

v is the final velocity

u is the initial velocity

t is the time taken

  Now convert the the final velocity to m/s;

          96km/hr to m/s;

               1 km/hr  = 0.278m/s

               96km/hr  = 96 x 0.278 = 26.7m/s

Now;

 Acceleration  = [tex]\frac{26.7 - 0}{3.07}[/tex]   = 8.69m/s²

So;

   v²  = u²  + 2as

v is the final velocity

u is the initial velocity

a is the acceleration

s is the distance

             26.7²  = 0²  + 2 x 8.69 x s

             712.89  = 17.38s

                  s  = 41.02m

A(n) 636 kg elevator starts from rest. It moves upward for 4.5 s with a constant acceleration until it reaches its cruising speed of 2.05 m/s. The acceleration of gravity is 9.8 m/s 2 . Find the average power delivered by the elevator motor during this period. Answer in units of kW.

Answers

Answer:

The average power delivered by the elevator motor during this period is 6.686 kW.

Explanation:

Given;

mass of the elevator, m = 636 kg

initial speed of the elevator, u = 0

time of motion, t = 4.5 s

final speed of the elevator, v = 2.05 m/s

The upward force of the elevator is calculated as;

F = m(a + g)

where;

m is mass of the elevator

a is the constant acceleration of the elevator

g is acceleration due to gravity = 9.8 m/s²

[tex]a = \frac{v-u}{t} \\\\a = \frac{2.05 -0}{4.5} \\\\a = 0.456 \ m/s^2[/tex]

F = (636)(0.456 + 9.8)

F = (636)(10.256)

F = 6522.816 N

The average power delivered by the elevator is calculated as;

[tex]P_{avg} = \frac{1}{2} (Fv)\\\\P_{avg} = \frac{1}{2} (6522.816 \ \times \ 2.05)\\\\P_{avg} = 6685.89 \ W\\\\P_{avg} = 6.68589 \ kW\\\\P_{avg} = 6.686 \ k W[/tex]

Therefore, the average power delivered by the elevator motor during this period is 6.686 kW.

Which type of telescope is best used to detect distant planets?​

Answers

I believe the answer would be, refractor type telescopes because these are best used for planetary observations.

Help! Help!

___ are a primary way to discourage drinking and driving.
A. High prices for alcohol
B. Scare tactics
C. Laws

Answers

Answer:

Laws

Explanation:

Laws are a primary way discourage drinking and driving

A primary way to discourage drinking and driving is Law.

What is drinking and driving?

The person who takes in alcohol and then drives on the road. This is strictly prohibited.

Laws against the  'drinking and driving' will make people get scared of getting charged or sentenced to jail for some years. Lot of accidents have caused when there were no laws against the action.

Thus, Laws are a primary way to discourage drinking and driving.

Learn more about drinking and driving.

https://brainly.com/question/11317786

#SPJ2

Two identical plastic cups contain the same amount of water at two different temperatures, as shown to the left. Both cups are placed in a room at 25° Celsius. At the time cups were placed in the room, in which cup do the water molecules have higher average kinetic energy? ( Cup 1 © Cup 2​

Answers

Answer:

the molecules will begin to move slowly and will turn to ice

Explanation:

hope this was good or not not sure if am right but yeah

Select the correct answer.
What type of motion means to bounce or spring back?

Spin
Rotate
Rebound
Speed

Answers

Answer:

Rebound

Explanation:

Answer:

Rebound is your answer

Explanation:

To rebound is to bounce or

spring back after coming into

contact with another object.

Examples:

Rebound

• A basketball rebounds off the

backboard.

• A hockey puck rebounds off

the wall.

If at some point in time an object has zero velocity and zero acceleration, what does that mean about its motion at the next instant

Answers

Answer:

Explanation:

Usually, when an object possesses 0 velocity, then the object is expected to be at rest. But like the popular saying, there's always an exception to every rule. There exists cases in which an object isn't at rest, but possesses 0 speed or velocity. Since acceleration is the rate of change of velocity with time, the acceleration becomes negative, instead of positive.

Again, when the acceleration becomes zero, it means that the object isn't moving or it has no speed. And thus, the body is at rest. Every moving body as an acceleration, either positive, or negative. Zero acceleration means the object is at rest, and not moving at all.

Please leave a like if it helped you

At any point in time, when

when the acceleration becomes zero, it means that the object isn't moving or it has no speed. And thus, the body is at rest.

What is acceleration?

Acceleration is defined as the change of the velocity with the time. Acceleration is a vector quantity and is defined by both the magnitude and the direction

when the acceleration becomes zero, it means that the object isn't moving or it has no speed. And thus, the body is at rest. Every moving body as an acceleration, either positive, or negative. Zero acceleration means the object is at rest, and not moving at all.

Now If an object is moving with an acceleration that causes its speed to be reduced, there will be a moment in which it reaches v = 0, but this doesn't necessarily mean that the acceleration isn't acting anymore. If the object continues its movement with the same acceleration, it's velocity will become negative.

If you throw an object in the air with a certain velocity, it will move vertically, reducing its velocity in a 9,8  rate (which is the acceleration caused by gravity). At a certain point, the object will reach its maximum height, and will start to fall. In the exact moment that it reaches the maximum height, before it starts falling, its velocity is zero, but gravity is still acting on the object (this is the reason why it starts falling instead of just being stopped at that point). Therefore, at that point, the object has zero velocity but an acceleration of 9,8 .

To know more about acceleration follow

brainly.com/question/25749514

A volleyball experiences 494 Ns of impulse over a time period of 7 seconds. What was the magnitude of the force that acted on the volleyball during this time period?

Answers

Answer:

70.6N

Explanation:

Given parameters:

Impulse  = 494Ns

Time  = 7s

Unknown:

Force applied = ?

Solution:

To solve this problem, we use the formula of impulse;

      Impulse = Force x time

Now insert the parameters and solve;

       494  = Force x 7

            Force  = [tex]\frac{494}{7}[/tex]  

          Force  = 70.6N

A boat is drifting to the right with a speed of 5.0 m/s when the driver turns on the motor. The motor runs for 6.0 seconds causing a constant leftward acceleration of magnitude 4.0 m/s squared. What is the displacement of the boat over the 6.0 second time interval?

Answers

Answer:

[tex]D= -0.42km[/tex]

Explanation:

From the question we are told that

Drifting right with speed 5.0m/s

The motor runs for 6.0 seconds

Leftward acceleration of magnitude 4.0 m/s squared

Generally the equation [tex]V=ut+1/2at^2[/tex] can be used here

[tex]V=ut+1/2at^2[/tex]

Mathematically solving with the newton equation above we have that

   [tex]D=5*6 + \frac{1}{2} (-4)*6^2[/tex]

   [tex]D=30-72[/tex]

   [tex]D=-42m[/tex] [tex]or -0.42km[/tex]

Therefore having this the Displacement is [tex]D= -0.42km[/tex] leftward

A 420 g soccer ball is kicked into the air with an initial velocity of 30 m/s. How much kinetic energy does the soccer ball have?

Answers

Answer:189000J

Explanation:KE=1/2mv^2

1/2(420g)(30m/s)^2

=189000J

The metal wire is stretched so that its cross-section is still circular but its total length is now 10 meters. What is the resistance of the wire after stretching

Answers

I don’t know I think about 20 meters but I’m probably wrong I just need to do this so someone can answer my question

please help thank you ​

Answers

YOUR QUERY :

which of the following statements BEST describes the difference between an atom and an ion ?

Answer:

well the correct answer is

d. An atom contains equal numbers of protons and electrons whereas an ion contains unequal numbers of protons and electrons .

Explanation:

A charged atom is known as an ion, well it can be negative as well as positive charge.

if atom has more protons than electrons then it get positively charged and known as cation

if the atom has more electrons that the number of protons then the atom get negatively charged and known as anion

let's say you hypothetically ran over someone with your car, and they are now under your car in between the front wheels and the back wheels, right, and they're stuck as in can't breathe type stuck, right, do you keep driving so they can breathe or do you let them chill under your car?
just curious...​

Answers

question: is this actually hypothetical?

Explanation:

also just leave the car there go get some McDonald's or sum and come back and if they're still breathing then go ahead and move the car .

Answer:

the same thing the last guy said

14. After finishing her homework, Sue climbs up a 5.00 m high flight of stairs to her bedroom
Find the magnitude of Sue's weight
and how much
work Sue does in climbing the stairs if she
has a mass of 50.0 kg? (4.90 x 2 N, 2450J)

Answers

Explanation:

Given parameters:

Height  = 5m

Mass of Sue  = 50kg

Unknown:

Magnitude of Sue's weight  = ?

Work done by Sue = ?

Solution:

Weight is the vertical force exerted by a body in the presence of gravity.

Mathematically;

        W = mg

m is the mass

g is the acceleration due to gravity  = 9.8m/s²

  Weight  = 50 x 9.8  = 490N

Work done  = Force x distance = weight x height

 Work done  = 490 x 5 = 2450J

( I will give a brainliest )
What must be changed, temperature or heat energy, during condensation?

Answers

Answer:

The answer is temperature lol

Explanation:

:)

How far will a 10N force pull a car if the work done is 20J?

Answers

Since Work done= Force x distance/displacement. Therefore substituting the values in and making Distance the subject of formula we get d=W/F =20/10 = 2 meters

how are hydrosphere, atmosphere, Biosphere, and Biosphere connected to one another

Answers

Explanation:

Such spheres are intimately connected. Many animals (biosphere), for example, migrate through to the sky, while groundwater (hydrosphere) also flows through the ground (lithosphere). The domains are actually so closely related that a shift in one globe always results in a shift in one or both of some other spheres.

A different bullet has a mass of 0.09 kg. Starting from rest, after its gun's trigger is pulled, a constant force acts on the bullet for the next 0.025 seconds until the bullet leaves the barrel of the gun with a speed of 1,346 m/s.

What force acts on this bullet?

Answers

The force acts on this bullet : 4.8456 N

Further explanation

Given

m=0.09 kg

Δt=0.025 s

vo=0(from rest)

vt=1.346 m/s

Required

Force

Solution

Impulse is a change in momentum

I=ΔP

F.Δt=m(vt-vo)

Input the value

F x 0.025 = 0.09(1.346-0)

F=4.8456 N

Other Questions
PLEASE HELP QUICKKKKWho acted as a bridge between the Romantic Period and the Realism Period?Heather Burnscontemporary poetsWalt Whitmanthe Fireside Poets PLEASE HELP ME!!!!! I need to know the best ways to make a small business known. I just started a small Scentsy business with my mom. I don't do social media and my moms is mainly her private friends even though it is public. AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA this is extra cedit in my class and i need it, can anyone help me out?? Bm meaning in marching band True or false - elderly people are living in poverty? which graph could represent a function ? ? The athletic departments at 10 randomly selected U.S. universities were asked by the Equal Employment Opportunity Commission to state what percentage of their nursing scholarships were presently held by women. The responses were 5, 4, 2, 1, 1, 2, 10, 2, 3, 5. what is the midrange Can someone answer these two problems?? Pls answer both I really need help... Can someone help me pleas Word count: 200+ wordsIntroductory sentencesConcluding sentencesSupporting details:Who was the inventor?What did he invent?Where did he invent it?When did he invent it?How does it work? Please help me ASAP Can anyone give me 1-2 sentences for an opening to a story relating to this picture? Will give brainliest for the best one:) 2 examples of peer pressure in The Sneetches How do the dwarfs react to Snow White's appearance in their home?A: The dwarfs demand that Snow White leave the cottage and return to the woods.B: The dwarfs are relaxed because they are used to visitors.C: The dwarfs admire her beauty and leave her undisturbed.D: The dwarfs are angry when they realize that their beds have been slept in. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish A history question ????help