Suppose you find a yellow piece of metal in a stream. How could you tell if it’s real gold?

Answers

Answer 1

Answer:

Bite it, if it is soft then its gold

also if it is not shiny

Explanation:


Related Questions

Which of the three traits considered in this film (bipedality, extensive tool use, and large brains) were present in the 3.2-million-year-old Australopithecus fossil (Lucy)?.

Answers

Answer:

The bipedality

Explanation:

One of the things the discovered fossil signified was that human bipedality was more ancient than the large brain size because Lucy actually had a small skull which could indirectly be translated to small brain size.

NOTE: Bipedality can be described to mean the ability of an organism to move about with two legs. Hence, it must have been discovered that Lucy had two legs.

What 3 traits have led to human evolution? And why?

Answers

Answer: bipedalism, brain expansion, and culture

Explanation:

7. Chemical or physical factor that determines the number
of organisms in a population

Answers

Answer:INTERSPECIFIC COMPETITION

Explanation:

The physical factor that determines the number of organisms in a population is ;   Interspecific competition

Interspecific competition in a population is a competition that exists between organisms of different species, while the competition that occurs within organisms of the same specie is termed intraspecific competition.

During Interspecific competition the different species compete for food, water and Habitat which every organism needs to survive, and in most cases the stronger specie overruns the weaker species and this will lead to the depletion in the number of the organisms of the weaker specie and an increase in the number of the stronger specie within the population.

Hence we can conclude that The physical factor that determines the number of organisms in a population is ; Interspecific competition .

Learn more : https://brainly.com/question/1638475

Which type of rock is non-foliated metamorphic rock?

Answers

Answer:

slate, phyllite,schist and gneiss

Answer:

Letter A: Gneiss

Explanation:

SOMEONE PLEASE HELP MEEEE you don’t have to explain just tell me if it’s true or false

Answers

Answer:

7. True

8. False

9. True

10. True

Explanation:

what do the nucleus cell, mitohondira cell, cell wall, chloroplast cell, cyptoplasm cell, and cell mabrane do?

Answers

Answer:

nucleus- this is where all genetic information is stored.

mitochondria- where respiration occurs

cell wall- gives the cell structure and prevents it from bursting

chloroplast- contain chlorophyll which stores energy from the sun for photosynthesis

cytoplasm- where chemical reactions occur

cell membrane- controls what comes in and out of the cell.

mitochondria: where respiration occurs

cell wall: gives the cell structure and prevents it from bursting

chloroplast: contain chlorophyll which stores energy from the sun for photosynthesis

cytoplasm: where chemical reactions occur

cell membrane: controls what comes in and out of the cell.

a. What is the major evolutionary advantage to producing an amnion?
b. What does that mean for embryonic development for the animal phylum as compared to the animal phyla?

Answers

WHAT IS THE MAJOR EVOLUTIONARY ADVANTAGE TO PRODUCING AN AMNION?

The main evolutionary advantage of producing an amnion is that the embryos of the amniotic membrane,the amniotes are made available with their own aquatic environment,this in-turn resulted to a lesser dependence on water for it's maturation and development therefore allowing or giving room for the amniotes to branch towards environments that are drier.

WHAT FOES THAT MEAN GOR EMBRYONIC DEVELOPMENT OF THE ANIMAL PHYLUM AS COMPARED TO THE ANIMAL PHYLA?

The embryonic development of animal phylum is also known as embryogenesis.

It is the development of the embryo from the point of fertilization of an egg,(the ovum) by a sperm cell ,this makes the fertilized egg a diploid cell otherwise known as a zygote.

This zygote undergoes mitosis,a mitotic division known as cleavage and a differentiation resulting in a multicellular embryo.

This embryonic development of animal phylum comprises of 36 animal phyla.

Budding is a type of asexual reproduction. Which of the following is an disadvantage for asexual reproduction?

Answers

Disadvantages of asexual reproduction include: offspring compete for food and space, extreme temperatures can wipe out entire colonies, negative mutations can destroy many offspring.

5. Explain how interactions and trade with Europeans affected West Africa?​

Answers

European Exploration Study Guide

Why did European countries compete for power in North America?

Economic—Gold, natural resources, and trade

Religious—Spread Christianity

Competitions for empire and belief in superiority of own culture

What were the obstacles faced by the explorers?

Poor maps and navigational tools

Disease and starvation

Fear of the unknown

Lack of adequate supplies

What were the accomplishments of the explorations?

Exchanged goods and ideas

Improved navigational tools and ships

Claimed territories

What regions of North America were explored and settled by France, England, and Spain?

Spain: Francisco Coronado claimed the Southwest of the present-day United States for Spain.

France: Samuel de Champlain established the French settlement of Québec. Robert La Salle claimed the Mississippi River Valley for France.

England: John Cabot explored eastern Canada.

What regions were explored by Portugal?

The Portuguese made voyages of discovery along the coast of West Africa.

How did the American Indians and Europeans interact with each other?

Spanish

Conquered and enslaved American Indians

Brought Christianity to the New World

Brought European diseases to American Indians

French

Established trading posts

Spread Christian religion

English

Established settlements and claimed ownership of land

Learned farming techniques from American Indians

Traded with American Indians

American Indians

Taught farming techniques to European settlers

Believed that land was to be used and shared but not owned

A peptide has the sequence of Gly-Ser-Glu-Leu-Ala-His-Gly-Arg-Leu-Ala-PheCys-Leu. (pKR=4.25, 6.0, 8.2, 12.5. Assume pKa’s of amino terminus and carboxyl terminus are 9.6 and 2.3, respectively.) The PI of the peptide is close to:_______

a. 7.1
b. 7.8
c. 5.1
d. 8.2
e. 10.3

Answers

Answer:

The correct answer is option a. "7.1".

Explanation:

One easy way to determine if a peptide sequence is acidic, basic or neutral is to check for the number of amino acid residues that are acidic, basic or neutral. In this case, most amino acid residues are neutral, which mean that under neutral conditions they have a pKa close to 7.0. Particularly, the content of 3 leucine, 2 alanine and 2 glycine residues determines that the peptide have a pI of around 7.1.

particles is found in the nucleus of an atom

Answers

Answer:

protons and neutrons

Explanation:

Protons and neutrons have a positive and neutral charge, respectively. They are in the nucleus, while the negative electrons orbit the nucleus.

Answer:

Protons, neutrons, electrons

Explanation:

If you're asking about subatomic particles.

Plzzzzz help I’ll mark brainliest

Answers

Answer:

Im pretty sure its B

Explanation:

Ecology.

The definition of ecology is: the branch of biology that deals with the relations of organisms to one another and to their physical surroundings.

This means that it is the study of how organisms interact with each other and their environment.

Not sure if it's right? Let's take a look at the other answers.

Definition of biosphere: the regions of the surface, atmosphere, and hydrosphere of the earth (or analogous parts of other planets) occupied by living organisms.

Definition of biotic: relating to or resulting from living things, especially in their ecological relations.

Definition of biome: a large naturally occurring community of flora and fauna occupying a major habitat, e.g. forest or tundra.

Hope this helps!

#LearnwithBrainly

How does Nitrogen get from the atmosphere to the soil?

Answers

Answer:

Plants get their nitrogen indirectly from the air via microorganisms in the soil and in certain plant roots.

Answer:

Microorganisms and certain plant roots in the soil

Explanation:

"Plants get the nitrogen that they need from the soil, where it's already been fixed by bacteria and archaea. Bacteria and archaea in the soil and in the roots of some plants have the ability to convert molecular nitrogen from the air (N2) to ammonia (NH3)... Such organisms are called "diazotrophs". From here, various microorganisms convert ammonia to other nitrogen compounds that are easier for plants to use. In this way, plants get their nitrogen indirectly from the air via microorganisms in the soil and in certain plant roots."

I hope this helps...

help me please !!!!!!

Answers

we find ATP

like glucose and other organic compounds

Which types of rocks can become metamorphic rock?

both igneous and metamorphic rock

clastic sedimentary rock

both igneous and sedimentary rock

clastic or chemical sedimentary rock

Answers

Answer:

both igneous and metamorphic rock I believe

Explanation:

I I learned this in fourth grade I'm not sure if I'm correct if I remember correctly then it's these two sorry if it's wrong also tell me if it's wrong I'll try to tell you the right answer if it is wrong okay

Answer:

igneous, sedimentary, metamorphic all can

Explanation:

Which purpose does a cell membrane play in eukaryotic cells?

Answers

The cell membrane controls the movement of substances in and out of cells and organelles. In this way, it is selectively permeable to ions and organic molecules.

according to the diagram the temperature where clouds form is?

Answers

Answer:

higher than the temperature near mountains

Explanation:

Answer: C. lower than the temperature on the ground

Explanation: Because on the chart it shows the temp on the ground is 92° but then the temp where clouds form is 60°. This means that the temp at the ground is higher than the temp at 6000ft.

The increase in the reproductive success of a species will have the greatest impact on the - size of that species’ population. competition within other communities in the biosphere.. success of other populations in the community. tissues that comprise organisms of that species.

Answers

Answer:

size of that species’ population.

Explanation:

The increase in the reproductive success of a species will have the greatest impact on the size of that species’ population.

A reproductive success rate means more individuals survive birth and get added to the existing population. The more the number of individuals added to a population, the more the size of the population of the species.

An increase in the population size of a species will only increase intra-species competition for resources but have no real impact on the success of other populations in the community.

Let's suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs?

Answers

Answer:

Potential targets:

1- DNA methyltransferases

2- Chromatin modifiers such as histone acetyltransferases, histone deacetylases, histone methyltransferases, etc.

3- Components of the RNA interference (RNAi) machinery such as Dicer, Argonaute, etc.

Explanation:

Epigenetics can be defined as the study of any heritable change in the phenotype that does not involve modifications in the DNA sequence. Epigenetic mechanisms can be classified into three major types: 1-DNA methylation, 2-histone modifications (e.g., acetylation, methylation, phosphorylation, etc), and 3-regulatory non-coding RNAs (e.g., miRNAs, lncRNAs, siRNAs, etc) that modulate target gene expression via the RNA interference pathway. There are different types of proteins that are involved in these complex epigenetic mechanisms, and those cited above represent only some examples that can be used as therapeutic targets.

Which of the following processes is driven by gravity?
1.) Evaporation 2.) Condensation
3.) Precipitation 4.) Freezing

Answers

Answer:

Precipitation

Explanation:

The process which is driven by gravity is precipitation. In the process of precipitation, the clouds formed by evaporation of water drops off in the form of rain. Thus, the correct option is 3.

What is Precipitation?

Precipitation is one of the main processes of water cycle. Water cycle is a biogeochemical cycle which involves the flow of water in the atmosphere through different processes such as evaporation, precipitation, and in different phases such as solids, liquids, and vapors.

Precipitation is the process of water cycle in which the clouds formed by the evaporation of water drops off back to the land in the form of rain. This process is driven by the influence of gravitational force.

Therefore, the correct option is 3.

Learn more about Precipitation here:

https://brainly.com/question/18109776

#SPJ2

Which type of rock does B represent?

Group of answer choices

Answers

I thing it is volcanic rock

1. Does a scientific theory ever become a law? Explain
the difference between scientific theory and law.

Answers

Answer:

a theory cannot become a law

Explanation:

the difference between a scientific theory and a scientific law because a theory is an in depth explanation of an observed phenomenon. a law is a statement about an observed phenomenon or an unifying concept (i.e.: newtons law or gravity - no explanation on how it works or what it is just that it exists.)

No a theory can not be a law

A strategy for fighting bacterial infections uses viruses. Viruses that infect bacteria are called bacteriophages. Phage comes from the Greek word for “eater.” Explain why it is not accurate to call a virus that kills bacteria a “bacteria eater." What happens when a virus attacks a cell?
help!!

Answers

Answer:

Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.

Explanation:

Viruses are structures formed by genetic material —DNA or RNA—covered by a protein envelope called the viral capsid. These structures do not perform the vital functions of a cell, so they are not considered living organisms.

A bacteriophage virus is characterized by using prokaryotic cells to replicate, destroying them in the process.

Viruses need a living cell to be able to replicate, so they introduce their viral genome into them to replace the genetic material of their nucleus and be able to multiply. They can do this:

Introducing the genetic material from outside the cell. Entering directly into the cell to be able to replicate.

Bacteriophage viruses do not eat the bacteria, they simply use it to reproduce, and then happens the lysis of the bacterial cell.

Answer:

Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.

Explanation:

Help me guys!! (Giving brainliest)

Answers

Answer: C

Explanation:

C because the cell membrane is semi permeable which means only certain substances can enter and exit.

How can acids be neutralized? What can form?

Answers

A neutralization reaction is when an acid and a base react to form water and a salt and involves the combination of H+ ions and OH- ions to generate water. The neutralization of a strong acid and strong base has a pH equal to 7

True or false consumption efficiency in Huckleberry patches is high like in a forest ecosystem

Answers

Answer:

True

Explanation:

(Q005) Humans are unusual because our cultural practices can actually change our environmental circumstances. We can change the environment in which natural selection acts on our traits. Describe how this process has played out in the evolution of adult lactose tolerance. Describe how this process has played out in the maintenance of the sickle-cell trait. Can you hypothesize any similar situations where our future evolution may be influenced by cultural practices we have today?

Answers

Answer:

sickle cell disease or sickle cell disease is about the inheritance of metaplastic cells or cells that do not respect normal cell morphology from the mother or father to a child.

This is not associated with cultures, instead lactose tolerance is.

Explanation:

Lactose tolerance is basically an adaptation of the body in those humans who continue to drink milk throughout their lives, once the growth stage is over, milk should be suspended, although some continue to consume it and lactase continues to be encoded and expressed.

Some people for cultural reasons or environmentalist lifestyles do not drink animal milk, but rather vegetable milk.

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

GTTCAAGCTACTGTTCAAGCTACT

. How are mineral deposits formed around vents?​

Answers

Answer:

When hot, metal-laden water spews from vents and mixes with the cold ocean, the metals precipitate. Large piles of sulfide accumulate on the seafloor and are eventually buried by sediments, modified by heat and pressure in the crust, and uplifted. Some are exposed on land when erosion removes the overlying rocks.

Using academic language, explain why we always see the same face of the Moon.

Answers

The simple answer (and one that you've probably heard before) is that we only see one side of the moon because the moon rotates around the Earth at the exact same speed as it rotates around its own axis, so that the same side of the moon is constantly facing the surface of the earth.
Other Questions
Prepare a limerick citing ways to prevent a disease. Howard can mow 3 lawns in 6 hours. How many lawns can he mow in 24 hours?Group of answer choices122163 PromptWrite a letter to a friend or relative whom you don't see often and tell them about your typical day. Your teacher invented another game: You will pick one card from a deck of cards. Ifyou pick a heart, you will win $25.00. Otherwise, you will lose $5.00.From the standpoint of the player, what is the expected value of this game?Enter expected valueWhat does the expected value tell us about the game?O The game is good to play, you will make money on average.O The game is NOT good to play, you will tend to lose money.O It doesn't matter if you play, you will generally break even. 4x + 11y = 36, What is the x intercept (let y = 0)? * Which equation shows the variable terms isolated on one side and the constant terms isolated on the other side for theequation 3x-5=-2x+ 10?A. X=5. B.5=x. C.15=5x. D.5x=15 Caleb paid $4.50 for 12 bagels. Which of the following have a unit price for bagels that is greater than the unit price Caleb pald? Select all thatapplyA) $2.25 for 6 bagolsB) $13.50 for 10 bagelsc) $3.30 for 6 bagolsD) $5.00 for 12 bagetsE) $8.10 for 18 bagels what is a good sentence with mustache in it? Has to be about 2 sentences and i will give brainiest answer the image if the point (5,-1) under a reflection in the y-axis is Wyle Co. has $3.9 million of debt, $1 million of preferred stock, and $2.1 million of common equity. What would be its weight on preferred stock What is the y-intercept of A line has a slope of -3 and passes through point (-5,4)? A synthetic fiber used in manufacturing carpet has tensile strength that is normally distributed with mean 75.5 psi and standard deviation 3.5 psi. How is the standard deviation of the sample mean changed when the sample size is increased from to ? Round all intermediate calculations to four decimal places (e.g. 12.3456) and round the final answer to three decimal places (e.g. 98.768). eduardo has 24$ saved . if he saves 8$ each week how much money will he in 5 weeks . Which is not an example of a "living" life process?A)SensitivityB)RestingC)GrowthD)Nutrition How does the use of cell technology benefit public health?It makes it possible to discover new anticancer drugs.It makes it possible to culture fewer types of cells.It makes it possible to regulate medical research.It makes it possible to avoid testing drugs in humans. Identify the parent function.yLO-55-5 3x+2y=154x-5y=-3What is the following system of equations prefix-root-suffix for the word mortuary? along with the definition of each prefix-root-suffix.For example metamorphosis meta- changing , morph - shape, osis - process of PLEASE I NEEEEED HELP ILL GIVE BRAINLISET Help me with this question quick PLZz