Studying which of the following would provide the best evidence that two organisms share a common ancestor?
A: Amino acid sequence
B: Dietary preferences
C: Habitat requirements
D: Social group interactions​

Answers

Answer 1

Answer:

A

Explanation:

Answer 2

Studying amino acid sequences would provide the best evidence that two organisms share a common ancestor.

Amino acid sequence is a series of bases with different letters usually four(A T C G or U)  this letter contains information of an individual when translated.

The amino acid sequence of 2 or more individuals can be compare to each other through the process called Blasting using a tool called Blast

Blast generates alignments or similarities between a amino acid or protein sequence.

For organisms that are phylogenetically close i.e related by an ancestor, there will be similarities between their DNA sequences when compared. The amino acid sequence of an individual contains the information of the individual and it is unique for each individual.

Hence, amino acids sequence provides the best evidence of organisms sharing a common ancestor.

for further details on amino acid sequence kindly check https://brainly.com/question/14366221

 


Related Questions

in which direction do particles in a solution move during passive transport

Answers

During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.

What is the importance of the different types of transportation?

In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.

Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.

Learn more about the different types of transportation here.

https://brainly.com/question/29764225

#SPJ6

If you have a viral infection, why should you cover your mouth when you sneeze? * To prevent other people from breathing in the viruses you expel To prevent viruses from infecting cells in your nose and mouth To keep as many viruses as possible in your own body To get all of the cold viruses out of your body and onto your skin.

Answers

Answer:

To prevent other people from breathing in the viruses you expel

Explanation:

CORRECT

For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
a) A – T – C – C – T – A – G – A – A – G – G – T __________
b) C – G – T – T – G – C – A – G – A – A – C – T __________
c) T – A – C – G – G – A – T – C – G – T – C – A __________

Answers

a) TAGGATCTTCCA
b)GCAACGTCTTGA
c)ATGCCTAGCAGT

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

HELP ME PLSSS someone

Answers

Answer: B

Explanation: The amount of salt in the inner circle is equal to the amount of salt in the outer circle.

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

What is the series of processes in which a plant converts sunlight into a useful simple sugar called?

division

choloplasts

photosynthesis

mitosis

Answers

Answer: Photosynthesis

Explanation: I had this question to and it should be correct. I’m sorry if not.

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

can u answer that question

Answers

Answer:

The synthesis of new proteins

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

Give SOME EXAMPLES OF NATURAL CYCLE CHECKPOINTS .

Answers

Answer:

For example, delays in mitosis are often ascribed to 'activation' of the mitotic checkpoint, a descriptor that fails to recognize that the checkpoint by definition is active as the cell starts mitosis. Conversely, the completion of mitosis in the presence of misaligned chromosomes is often automatically interpreted to indicate a defective checkpoint, even though in the absence of critical testing alternative interpretations are equally likely. In this article, we define the critical characteristics of checkpoints and illustrate how confusion generated by the inconsistent use of terminology may impede progress by fostering claims that mean very different things to different researchers. We will illustrate our points with examples from the checkpoint that controls progression through mitosis

Explanation:

Answer:

Below

Explanation:

G1 checkpoint, also known as the Start or restriction checkpoint or Major Checkpoint; the G2/M checkpoint; and the metaphase-to-anaphase transition, also known as the spindle checkpoint.

Explain what is ecological conservation and conservation of the environment. What can you do to conserve the environment? Why do you think it is important to conserve the environment.

WILL NAME BRAINLIST!

Answers

Answer:

Conservation ecology is the branch of ecology and evolutionary biology that deals with the preservation and management of biodiversity and natural resources. Its goal is to find ways to conserve species, habitats, landscapes, and ecosystems as quickly, as efficiently, and as economically as possible.

-These are some examples of how we can conserve the environment:

Recycle your rubbish and participate in or help organize recycling campaigns.

Avoid littering and participate in or help organize litter clean-ups (here you can link to a website for volunteering or starting your own beach clean-up).

Use less plastic by, for example, carrying a reusable water bottle, saying no to disposable straws and cutlery, avoiding plastic toys, and bringing your own shopping bags (for further ideas on a plastic-free life take a look here).

Swap toys, movies, and books instead of buying new ones.

Donate, recycle, and repair electronic devices (see how here).

Use less water when brushing teeth, taking a shower, or washing the dishes.

Use less electricity by turning off lights and electronic devices when not in use, using energy-saving light bulbs, and hanging clothes to dry.

Use public transport, share a journey with friends (e.g., car-sharing), cycle, or walk when possible.

Use less paper by not printing unnecessary things and reading e-books.

Turn down the air conditioning when it is hot and use fans if you are still hot-they use much less power.

Turn down the heat when it is cold and use sweaters, blankets, and socks to keep warm.

Do not waste food and try to buy food that is grown locally and in season.

Hope this helps:)

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

How do mutations lead to variation?

A.
by providing a source of energy for cells
B.
by signaling proteins to be synthesized
C.
by giving organisms new features for survival
D.
by producing changes in the genetic code

Answers

Answer:

c

Explanation:

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?

Answers

it’s b, meiosis is mixing both parent cells genetic information therefore their offspring have a better chance at sieving

Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.

The correct answer is:

Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.

The significance of meiosis can be explained as:

Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.

The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.

Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.

Thus, meiosis is an important step in the genetic variation and survival of the organism.

Therefore, option B is correct.

To know more about meiosis, refer to the following link:

https://brainly.com/question/11622266

What number go in each circle ?
What number go in both circle?

Answers

Answer:

1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.

Also:

8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.
Other Questions
18 piontsA writer begins to develop a topic for an informative essay bycreating a clear thesis statement.creating a list of research questions.writing an effective conclusion.organizing the essays main points. Please help me find the value of x Base your answer on the following passage and on your knowledge of social studies."Congress of the United States begun and held at the City of New-York, on Wednesday the fourth of March, one thousand seven hundred and eighty nine.The Conventions of a number of the States, having at the time of their adopting the Constitution, expressed a desire, in order to prevent misconstruction or abuse of its powers, that further declaratory and restrictive clauses should be added: And as extending the ground of public confidence in the Government, will best ensure the beneficent ends of its institution..."Source: Joint Resolution of Congress Proposing... Amendments to the Constitution, 1789The main idea of this quote was influenced most directly by which political group?A) abolitionistsB) AntifederalistsC) RepublicansD) Federalists A 3900 kg truck is moving at 6.0 m/s what is the kinetic energy -6 -3x=5x -4x can somebody solve this ? Which expression is equivalent to 6n - 24?* 8n - 10+143/4 (8n - 32)-2(-3n - 12)O 10n - 12 - (4n - 12) Which word or phrase best completes this conversation?Sophie: Je veux acheter une maison dans la banlieue de Paris mais je n'ai pas assez d'argent.Jean: Si tu veux acheter une maison, tu doisOA. louerOB. acheterO C.souscrire un crditOD. prendreResetNext Robert is risk manager at TPT Bank has been asked to implement an updated badge reader system for addressing access control risk. Even though the risk was migrated, Robert observes some remaining risk linked with access control. What type of risk has been observed by Robert what was the average speed of the winner in miles per hour? Explain I need help please ! The graph shows the proportions of red and blue food coloring that Taylor mixes to make the purple frosting. What is the slope of the line? Tell what it means in the problem situation. The graph is ( 50, 70 ) ( 25, 35 ) Find the missing side, round to the nearest tenth.1530* Plz, Help me with this question. For a given input value q, the function f outputs a value r to satisfy the following equation.11q 4= 3r - 6Write a formula for f(q) in terms of q.f(q) = What does the phrase constant velocity indicate?a. zero distanceb. zero accelerationc. constant accelerationd. deceleration According to Euclidean geometry, a plane contains at least Create a five station circuit to practice and develop skills for a specific sport. Give the purpose free station. When and where was Adolf Hitler born? * PLEASE HELP!!!What is the meaning of this quote from "The Scarlet Letter"Be not silent from any mistaken pity and tenderness for him; for, believe me, Hester, though he were to step down from a high place, and stand there beside thee, on thy pedestal of shame, yet better were it so, than to hide a guilty heart through life. plz save me I need help as sonic