Solve: 32 = y + 12.4 y = _____

Answers

Answer 1

Answer:

ok the answer is 32=y+12.4y=12.32

Step-by-step explanation:

Answer 2

Answer:44.4

Step-by-step explanation: add 12.4 + 32


Related Questions

What is a fraction equal to 2/3? *

Answers

Answer:

Here are multiple :)

4/6

6/9

8/12

10/15

12/18

14/21

16/24

Hope this helped!

Answer:

2/3 | 4/6 | 8/12 | 16/24 | 6/9 | 10/15 | 14/21 | 16/24 | 18/27 | 20/30

what is this? answer quickly please

Answers

Answer: t= 11.5

Step-by-step explanation: 5 + (-11.5+3) = 3.5

Answer:

T = -3.7

Step-by-step explanation:

We begin with the given equation.

5(t+3)=-3.5

Distribute 5 throughout parentheses.

5t + 15 = -3.5

Move 15 to the other side and switch signs.

5t = -3.5 - 15

Combine like terms.

5t = -18.5

Divide by 5t.

t = -3.7

Jacob paid $89.59 for a portable e-book reader plus 9% tax. What is the cost of the
e-book reader including tax?

Answers

Answer:

$97.65

Step-by-step explanation:

$89.59 + $8.06 = $97.65

A rectangular table top has dimensions as 1.52m and 0.75m. Find the perimeter in cm

Answers

That is a question about perimeter of rectangle.

The perimeter of a geometric shape is the sum of the value of the all sides.

In a rectangle, the opposite sides are cogruentes (equals). For example, look at picture below. In that rectangle, the sides AB and DC are equals, and the sides AD and BC are equals.

So, the sides of that rectangular table are: 1.52m, 1.52m, 0.75m and 0.75.

Therefore, the perimeter of that rectangle is [tex]1.52+1.52+0.75+0.75= 4.54[/tex]m.

But that is not the final answer because that is the perimeter in meters and the question want the answer in centimeters.

1 meter has 100 centimeter, so we need to multiplicate the perimeter by 100.

Thus, the perimeter of that rectangular table is [tex]4.54\cdot 100 = 454[/tex]cm.

2/3 + 3/8 = ?

F. 1/6
G. 5/24
H. 5/11
I. 1 1/24

Answers

The answer to this problem is H
It would be G because you would need to multiple the denominators and add the numerators

construction worker’s planned to secure a tall pole using two cables attached to the pole at a point 12 m above the ground as shown in the diagram below.
based on the information in the diagram which value represents the total length of the cable that is needed to secure the pole?

Answers

Answer:(24+12\3)m

Step-by-step explanation:

ABCD – FECG
what does (x) =

Answers

9514 1404 393

Answer:

  x = 12

Step-by-step explanation:

Sides of similar figures are proportional, so ...

  AB/FE = BC/EC

  x/6 = 10/5

  x = 6·(10/5) . . . multiply by 6

  x = 12

Someone plz help me have a great day ツ

Answers

Answer

What’s your scratch username

Answer:

11 weeks and 3 days

What is the percent composition of Hydrogen in Acetone, C3H6O?
a, 62.0%
b, 10.4%
c. 27.5%
d. 19.9%

Answers

It’s c) I did this before I’m sure I’m sorry if it’s wrong
I think c (sorry if I’m wrong)

Is (2,5) a solution to this system of equations?
3x + 2y = 16
x + 14y = 13
yes
no

Answers

Answer:
No

Explanation:

need a correct answer please

Answers

Answer:

102°

Step-by-step explanation:

∠PQR = ∠PQS + ∠SQR

12x - 6 = 16 + 9x + 17

3x = 27

x = 9

∠PQR = 102°

-6k+7k
So I'm not sure that it's k because I need to simplify? Can someone help me

Answers

Answer:

k

Step-by-step explanation:

its just k, since 1k can be simplified to just k

It’s K since 1k equals K times 1 which equals k

The ratio of males to females was 4:5. If there are 180 people at the fair how many males
are there?

Answers

9514 1404 393

Answer:

  80

Step-by-step explanation:

Let m represent the number of males. Then you have ...

  m/(180 -m) = 4/5

  5m = 4(180 -m) . . . . cross multiply

  9m = 720 . . . . . . . . add 4m, simplify

  m = 80 . . . . . . . . . . divide by 9

The number of males at the fair was 80.

PLEASE HELP!! Will mark brainlest!!
Which number is equivalent to 16 1/2
A. 2
B. 4
C. 8
D. 32

Answers

Answer:

I'm not even lying, it's none of them ;-;

btw if you want, can you give me brainliest :((

Answer:

4

Step-by-step explanation:

16^(1/2)

when bringing a number to the power of a fraction the denominator becomes the order of the root and the numerator becomes the power of the number

we are left with an order 2 root, which is a square root

[tex]16^\frac{1}{2}=\sqrt[2]{16}=4[/tex]

i need help again><><><><>

Answers

First thing first your gonna have to find the area of the triangle within the rectangle.

Area of triangle = 1/2 b x h
= (1/2 9) x 4
= 4.5 x 4
= 18 cm square


Then after finding the area of the triangle your gonna find the area of the rectangle.

Area of rectangle = length x width
12 x 4 = 48
= 48 cm square


Then your gonna subtract the area of the triangle from the area of the rectangle.

Area of rectangle = 48 cm square
Area of triangle = 18 cm square
= 30 cm square

So the shaded region is 30 cm square

Solve using the quadratic formula: 2x^2 + 5x + 1

Answers

Answer:

x = -0.22   or x = -2.28

Step-by-step explanation:

2x^2 + 5x + 1 = 0

You use the quadratic formula: -b ±√5² - 4 x 2 x 1 ÷ (2 x 2)

-5 +√17 ÷ 4 = -0.22

-5 - √17 ÷ 4 = -2.28

round 2.33459 to the hundreths place

Answers

Answer:

2.33

Step-by-step explanation:

Answer:

go to your hundredths place. since 4 is not greater than 5 then it would round down. so the final answer would be 2.33

The sum of two numbers is 4. The larger number is 12 more than three times the smaller number. What are the numbers?

Answers

Step-by-step explanation:

So, we will take one of the numbers = x

And the other is 12 more than 3 times it, so = 3x + 12

So they said if we add them, we will get 4

So x + (3x + 12) = 4

4x + 12 = 4

4x = 4 - 12

4x = - 8

x = - 8 ÷4

x = - 2

So one of the numbers x = - 2

The other is 3x + 12

So x = - 2

3x +12 = 3(-2) + 12

= 6

So the 2 numbers = 6 and - 2

Lets check!

6 + (-2) = 4

So it's right!

I need help please help me number 3 and 4

Answers

3. is 10 add 5 or round 5 its 10  4. is 28 and i just added sorry if 4 is wrong

A crane lifts a pallet of concrete blocks 7ft from the back of a truck. The truck drives away and the crane lowers the pallet 11ft What is the final position of the pallet relative to where it started in the back of the​ truck?

Answers

Answer:

The position of the concrete relative to its initial position is 4ft behind its initial position

Step-by-step explanation:

Let us analyze the problem following the sequence of events.

First of all, the crane is initially 7 ft from the back of the truck.

Once the truck drives away, the crane lowers the concrete at 11 ft away from the back of the truck.

To get this distance relative to the initial position, we have to subtract the initial position from the final position of the concrete.

This will  be

11ft - 7ft = 4 ft

The position of the concrete relative to its initial position is 4ft behind its initial position

BRAINLEST answer !!


Find the value of y


Answers

Answer:

6 it's the same as the one next to a and b that's also 6

Pls explain how you got the answer also ☺️

Answers

Answer: x = 250

Step-by-step explanation:

-17 + x/5 = 33

+17 on each side to get rid of the 17

x/5 = 50

Multiply each side by 5 to cancle out the 5 and isolate the variable

x = 250

help pleaseeeeeeeeeeeeeeeeeeeeeeeeeeeee

Answers

Answer: C. 1 - x

Step-by-step explanation:

1/100 = 0.01

10/100 = 0.1

1 - 100 = -99

10 - 100 = -90

Answer:

C

Step-by-step explanation:

A. 1/100

B. 10/100=1/10

C. 1-100=-99

D. 10-100=-90

For smart ppl who are good at graphs, inputs, and outputs.

Answers

Answer:

I believe the output is f(6) is -1, the output of f(2) is -4, and f(x)=-4 has the outputs of  2, 4, 8, and 10.

I think.

help plz answer thank you

Answers

3 + 4, 3x3 equals 9 meaning your fraction would be 3

At Shop and Save Grocery Store, apples cost $3.59 a pound. If you buy 2.5 pounds, how much will it cost? Round your answer to the nearest cent.

Answers

Answer:

$8.98

Step-by-step explanation:

3.59+3.59+1.80

The answer would be $8.98. If each pound of apples costs $3.59 cents and you buy 2.5 pounds, your equation would be 2.5(3.59)=8.98.

HELP I NEED HELP ASAP

Answers

Answer:

A

Step-by-step explanation:

Process of elimination shows that the most reasonable answer is A.

Triangle MNO is an equilateral triangle with sides
measuring 16/3 units.
What is the height of the triangle?

Answers

Answer:

24

Step-by-step explanation:

answers for the 2 boxes please :)​

Answers

(-3,-4) you can double check by plugging the values into a calculator if you want

A lake is 3/4 mile wide. Chandler sailed 4/5the width of the lake How far did Chandler sail ​

Answers

Answer:

1/6

Step-by-step explanation:

Chandler sailed 1/6 of the lake

Answer:

About .6 or 3/5 simplified

Step-by-step explanation:

Other Questions
Write the inverse of each function. a. f(x)=x103b. g(x)=3/4x+6Please help me I beg you!!!! 25 points!!!! I need to pass!!! A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Abdul bought a loaf of bread for $1.59 and a package of cheese for $2.69. How much did Abdul spend? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. When Muhammad was a boy, he received religious teaching from whom?Group of answer choicesJewsPolytheistsProtestant ChristiansNestorian Christians condemned to be heretics Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls In tundra vegetation the soil is frozen from____ cm down what is the answer 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Which two numbers have a mean of 10 and a range of 4?NEED THIS ASAP PLEASE I WILL LEAVE A GOOD RATING