Question 10 of 14
Societies developed mediums of exchange in order to:
A. create a barter system of trade.
B. stop trading with paper money.
C. stop trade with foreign countries.
D. help people trade more easily.

Answers

Answer 1

Answer:

the answer is D

Explanation:

Answer 2

Answer:

D. help people trade more easily.

Explanation:


Related Questions

Under the rule of Octavian, what role did the Senate play?

a. They commanded the military.
b. They acted as advisors to Octavian.
c. They made the laws.
d. They wrote Rome's budgets and raised taxes.

Answers

Answer:

D

Explanation:

I am a history teacher.

Answer:

b

Explanation:

What is the difference between creative and team working skill

Answers

Some of the best examples of creative thinking skills may include: lateral-thinking, visual reading, out-of-the-box thinking, copywriting, artistic creativity, problem-solving, analytical mind, and divergent thinking. Here are the best creative thinking techniques you can use.

Here are seven teamwork skills that are essential for your academic and professional success:

Communication. Communication is the foundation of effective teamwork. ...

Time management. ...

Problem-solving. ...

Listening. ...

Critical thinking. ...

Collaboration. ...

Leadership.

Hope it helps

help plz and dont answer if u dont know plz

Answers

Answer:

Tsunamis and earthquakes

Answer:

Tsunamis and earthquakes

Explanation:

plz mark brainly

Question 7
Which of the following is the MOST accurate result of the era of Reconstruction on Georgia's economy?

Answers

Answer:

The answer is B

Explanation:

Answer:D

D

Explanation:

Do you think he would approve of the way we treat one another today?
Why or why not?

Answers

Answer:

no

Explanation:

everyone literally so rude in the internet nowadays :c

also who's 'he' in your question?

definitely not, he wanted peace although world peace will never happened. but he wouldn’t like or approve of what’s happening in the world today

After four years of war and 9 million people died, World War I ended by?

Answers

Answer:

July 28, 1914 – November 11, 1918

Explanation:

Having an ________, or a home children have left to be on their own, allows couples to have more time together.

A. retirement stage
B. parenting stage
C. empty nest
D. family life cycle

Answers

I believe the answer is C

why is the dead sea not actually a sea, and what kind of body if water is it?​

Answers

Answer: It is a salt lake, it is not connected to the ocean, it only has one source wich is the jordan river. The body of water is called the salt sea

Explanation:

how can the province take advantage of land covered with snow?​

Answers

Answer:

Tourism.

Explanation:

the province take advantage of land covered with snow by promoting tourism in this region. People around the world visit beautiful and cold places for their tour so this snowy land is attracted the people towards itself. There is no agriculture is possible in this region due to unfavorable environment so tourism is the only industry which can make the land to earn some valuable money which improves economy of the country.

true or false.
Water scarcity in the Southwest is caused by climatic issues.

Answers

true, the southwest has a very dry climate

Answer:true

Explanation:

With warmer weather comes longer droughts

What 3 countries are the Axis Powers?

Answers

Answer:

Germany, Italy, Japan

Explanation:

hope that helps :)

why does east asiahave such a great range of climates?

Answers

Answer:

Taiwan is farther south, producing a warmer tropical type A climate. The mountainous islands of Japan have been formed as a result of tectonic plates and are prone to earthquakes. Since water moderates temperature, the coastal areas of East Asia have more moderate temperatures than the interior areas do

Which Latin American country has the most free (from government control) economy?
(15 points)
A. Mexico
B. Brazil
C. Cuba

Answers

Answer:

I think Mexico, im not very sure tho

Explanation:

Answer:

I'm positive it's Mexico, A

Explanation:

Mexico has a 63.37 percent economic freedom rating, so i believe it's A

Who made up the five main special focus interest groups during the reconstruction?

Answers

Answer:

I'm not too sure about that one sorry kido

How could new equipment replace laborers?
O cost less than workers
O produce at a faster rate than workers
O easier to train than workers
o continue established ideas on farming

Answers

Answer:

The answer is B: they produce at a faster rate than workers

Explanation:

why did the little rock nine happen

Answers

The Little Rock Nine were a group of nine black students who enrolled at formerly all-white Central High School in Little Rock, Arkansas, in September 1957. Their attendance at the school was a test of Brown v. Board of Education, a landmark 1954 Supreme Court ruling that declared segregation in public schools unconstitutional.

What has happened to China’s GDP since it began to reform its economy

Answers

Explanation:

Since opening up to foreign trade and investment and implementing free-market reforms in 1979, China has been among the world's fastest-growing economies, with real annual gross domestic product (GDP) growth averaging 9.5% through 2018, a pace described by the World Bank as "the fastest sustained expansion by a major ?

Answer:

It increased immensely

Explanation:

It has the fastest growing economy in the world

Two ways failure of equipment can affect the communication process

Answers

Answer:

When your phone broke you will be frustrate same with computer.

Explanation:

3. |_The basic function of all governments is protection and security for its citizens.

Answers

Answer:

1. Protect the Natural Rights.

Explanation:

The primary functions of government are to protect the basic human rights which include right to life, liberty and to possess property.

Which statement describes the effect of Charlemagne's conquests on Europe?
Europe was brought together as a single empire.
Europe became divided into small warring states
Europe developed into powerful city-states
Europe separated into two rival kingdoms.

Answers

Answer:

Europe was brought together by a Single Empire

Explanation:

Sorry hope I’m not to late

Plzz help meee here're

Answers

Answer: I'm not sure man

Explanation: school sucks

Why did the Confederacy pass the Conscription Acts?

The Army wanted to be able to reward those willing to volunteer for service in the Confederate Army.
The Army needed to establish a series of laws for appropriate behaviors for troops during the Occupation of New Orleans.
The Army wanted to curb the practice of wealthy people avoiding military service by paying poorer people to serve in their place.
The Army needed more people to serve in the Confederate Army as the number of volunteers declined and the number of casualties increased.

Answers

Answer:

The Army needed more people to serve in the Confederate Army as the number of volunteers declined and the number of casualties increased.

Explanation:

The conscription act effectively reduced the minimum age to enter the military to 17 year olds. The confederates states passed this act as a desperate attempt to survive the waves attack from the northern state

At that time, the northern states have advantages in both numbers and military's technologies. So, many people in the southern states felt pessimistic that they could won the civil war. This cause the gradual decrease in the number of volunteers that led to the creation of conscription act.

Answer:

what that person said. the answer is d

Explanation:

Everything that defines the identity of a specific group of people, including their common traits and customs, is called ________.

A. culture
B. empty nest
C. society
D. tradition

Answers

I think it’s culture that’s what I would guess or tradition
A). Culture
It’s a groups way of life , including the shared sets religious practices and life styles.

How did Syrian rule differ from Persian rule for Jewish people?

The Syrians enslaved all conquered people, while the Persians enslaved the Israelites.
The Syrians eventually outlawed Judaism, while the Persians encouraged free worship.
The Syrians encouraged freedom of religion, while the Persians banned the Jewish religion.
Syrians built new houses of free worship, while the Persians destroyed the Jewish Temple.

Plz help me :(

Answers

Answer:

Syrians built new houses of free worship, while persians destroyed the jewish temple. Hope it helps!

Explanation:

Which city is located at 19°S, 48°E? *

Answers

Answer:

Bombay?

Explanation:

Answer:

toamasina??

Explanation:

Which choice is true of all the Aboriginal peoples’ myths concerning the sun?

The sun roasted humans over a fire.


The sun is always named Alinga.


The sun lit the sky to find her lost son.


The sun is a female goddess.

Answers

Answer:

the second one i think hope this help

Explanation:

Answer:

The sun is a female goddess.

Explanation:

Aboriginal people are indigenous groups in Australia. They have a strong connection with nature that they even have various myths concerning the "sun." Among the choices above, it is the last choice (The sun is a female goddess) that is true of all Aboriginal people. She is perceived in different names according to different locations in Australia. For example, the sun is called "Bila" in Southern Australia, but is called "Gnowee" in Southeastern Australia. This means that she is not always named as "Alinga." Despite having different names, the sun is largely believed to be a female goddess.

How is the nation responsible for its citizen?What does it expect from them in return? Mention four point​

Answers

Answer:

Obeying the law. Every U.S. citizen must obey federal, state and local laws, and pay the penalties that can be incurred when a law is broken.

Paying taxes. ...

Serving on a jury when summoned. ...

Registering with the Selective Service

Explanation:

States have the legal obligation to protect and promote human rights, including the right to social security, and ensure that people can realize their rights without discrimination.

In some experiments on the pain of being rejected, participants played a ball-tossing game while their brains were being scanned in an fMRI. Those excluded during the game showed increased activity in areas of the brain involved in the experience of pain. However, when they were given __________, these regions did not show heightened activity.

Answers

Answer:

i taks=e muy house to my old toun roe

Explanation:

How many battles were fough in 1779?

Answers

Answer:

8

Explanation:

Battle of Kettle Creek – February 14, 1779; Battle of Vincennes – February 23–25, 1779; Battle of Brier Creek – March 3, 1779; Battle of Penobscot Bay – June 17, 1779 – August 13, 1779; Battle of Stono Ferry – June 20, 1779; Battle of Stony Point – July 16, 1779; Battle of Newtown -August 29, 1779; Siege of Savannah – September 16 – October 18, 1779; 1780

What was Hamilton's plan for the economy and why did congress oppose it?

Answers

Answer:

Hamilton's plan for the new country's financial system had three major parts. Assuming the states' debts by issuing interest-bearing bonds was the first part of the plan.

Explanation:

Hamilton also instituted tariffs for imported goods as a way of raising federal revenue and helping domestic businesses

Other Questions
An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit.........