Answer:
geologists use rock samples and direct evidence to prove what earth's structure is like.
Explanation:
what tissue breaks down food for energy
Answer:
When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.
Which statement best
summarizes agricultural technology
over time?
A. Agricultural technology has
continually advanced over time, with
significant leaps forward during the
Agricultural Revolution and the Green
Revolution.
B. Agricultural technology
advanced quickly during the
Agricultural Revolution and the Green
Revolution but hasn't advanced since.
C. Agricultural technology didn't
advance before the Green Revolution.
D. Agricultural technology didn't
advance before the Agricultural
Revolution.
Agricultural technology has evolved over time, with significant leaps during the agricultural and green revolutions.
Agricultural revolutionAgriculture has been one of the sustainers (along with hunting) of early men and as such, has seen gradual development with time. Man has always been looking for better ways to do things in order to achieve outcomes.
With the era of the agricultural revolution, there was a huge transition of humans from the primitive lifestyle of hunting and fruit gatherings to that of agricultural settlements. Better ways to carry out crop production started receiving huge attention. from there, hand-made agricultural equipment started surfacing.
The green revolution has agriculture receiving utmost attention in terms of technological innovations. Farm machinery, agrochemicals, etc, started coming up with the result being a massive increase in crop production and general outputs.
More on agricultural revolutions can be found here: https://brainly.com/question/14121608
#SPJ2
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
And, what else it literally says CHECK ALL THAT APPLY like....
Answer:
i dont understand??????
Explanation:
Answer:
What??
Explanation:
This makes no sense to me...
the combination of a heart arteries and veins and capillaries is____
Answer:
A (an organ system)
Explanation:
A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?
Answer:
Add magnet to the bowl, cover the bowl, and shake well
Explanation:
Anything with MAGNET
An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as
Answer:
This organism is best classified as an autotroph.
Explanation:
Autotrophs can make their own food.
explain how water properties help get water from the roots of plants to leaves
Answer:
In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.
Explanation:
I need help. Due today.
Answer:
D) common ancestry among vertebrate species
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
Artificial selection applies only to dog breeding?
True OR False.
Answer:
Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.
true...?
Explanation:
Answer:
False.
Explanation:
The bananas we have today were created using artificial selection. Same thing with peanuts by the way.
plz help me i beg of you!???
Answer:
Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.
Explanation:
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
Pls help :)) worth 10 points (:
Answer:
A
Explanation:
just go for A
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
MARKING PEOPLE AS BRAINLIDT IF CORRCET
True or False: Bone cells contain different DNA than blood cells.
Answer:
True the bone cells do have different DNA than blood
Explanation:
Help. It is due today
Answer: B
Explanation: tadpoles lack limbs and possess longtails, adult frogs on the other hand have two hind limbs and two fore limbs
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.
Answer:
1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion
The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.
What are hypothesis?A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.
Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.
Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.
The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.
A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.
Thus, by using these steps, scientist can come to an end for the problem.
For more details regarding hypothesis, visit:
https://brainly.com/question/17173491
#SPJ2
An idea in science is supported or rejected after several
Question 23 options:
publications
experiments
alterations
meetings
Answer:
experiments
Explanation:
Answer:
experiments
Explanation:
I took the test
Lister cultured the bacteria responsible for milk spoilage.
True
False
Answer:
True
Explanation:
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
Desert plants and animals are adapted to the lack of what and high
Answer:
lack of water and high concentration of heat and dryness
Explanation:
Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.
hope this helped:)
Is a seed a living organism
Answer:
Yes they are living organisms
The most common presenting sign/symptom with rheumatic fever is a. rash. b. painless nodules. c. polyarthritis. d. cardiac murmur.
Answer:
c. polyarthritis.
Explanation:
Rheumatic fever is an inflammatory disease that may affect different parts of the body including joints, heart, brain, and skin. It is a rare disease observed after a bacterial throat infection caused by Streptococcus (group A). The most common signs of this disease include swollen and/or tender joints (i.e., polyarthritis), especially in wrists, knees, elbows or ankles, fever, fatigue, pain in the chest, breathlessness, palpitations, etc. Rheumatic fever needs to be treated by antibiotics to eliminate group A Streptococcus infections.
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
Which relationship is an example of commensalim?
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA
Answer: Complementary base- pairing creates a very stable structure
Explanation:
The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.
A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.
In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).
Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.
Read more: https://brainly.com/question/19755749