Answer:
Its c the third answer
Explanation:
An individual who exhibits a mixture of schizophrenic symptoms most likely has undifferentiated schizophrenia. Please select the best answer from the choices provided OT OF
Answer:
True
Explanation:
An individual who exhibits a mixture of schizophrenic symptoms most likely has undifferentiated schizophrenia.
The most likely diagnosis for someone who displays a variety of schizophrenic symptoms is undifferentiated schizophrenia. The aforementioned is therefore True.
What is schizophrenia?The illness that impairs a person's capacity for clear thinking, feeling, and behaviour is schizophrenia. Although the precise origin of schizophrenia is unknown, it is thought that a mix of genetics, environment, and changes in brain chemistry and organization may be at play.
Schizophrenia is characterized as disorganised speech or behaviour, depressed participation in daily tasks, and ideas or experiences that appear disconnected from reality. Memory loss and attention problems could also be present.
Therapy is typically ongoing and frequently consists of a mix of prescription drugs, psychotherapy, and well-coordinated specialty care services.
So, the given statement is True.
Learn more about Schizophrenia, here:
https://brainly.com/question/8611812
#SPJ7
Which organs are shaped like beans and are located just below your ribs, in the middle of your back?
Answer: Your kidneys are bean-shaped organs, each about the size of your fist. They are located near the middle of your back, just below the rib cage.
Explanation:
Answer:
Kidneys
Explanation:
The kidneys are two bean-shaped organs, each about the size of a fist. They are located just below the rib cage, one on each side of your spine. Healthy kidneys filter about a half cup of blood every minute, removing wastes and extra water to make urine.
Strands of genetic material floating in the nucleus are refered to as_____
Which of the following is an example of a producer-consumer
relationship?
productor?
Worm --> Bird
Leaf --> Tree
Fish --> Bear
Grass --> Deer
Answer:
Grass and Deer
Because Grass is consumer and Deer is producer
6. Catalase is an enzyme that speeds up the breakdown of hydrogen peroxide. The enzyme increases the rate of reaction, so it is 700 times faster. If the enzyme reaction took 1.9s how long would the reaction take if there was no enzyme? Convert the answer to minutes. Give your answer to 4sf.
Answer:
0.00004524 minute
Explanation:
The enzyme is Catalase, and it speeds up the rate of reaction by 700 times than what it was supposed to be.
If the already sped up rate of reaction is 1.9 seconds, then the initial reaction ought to have taken
1.9/700 seconds and that is 0.0027143 second.
We're asked to convert to minute, we then have
0.0027143/60 which is equal to 0.0000452381 minute.
Since we're asked to round off to 4 significant figure, we have 0.00004524 minute.
3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances
Answer:
The movement of specific substances into and out of the cell is controlled by the cell membrane.
Explanation:
The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.
Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated
Answer:
I'm going to say A
Explanation:
because it just make more sense
Is this person male or female? Why?
Answer:
I can't tell you why, but I think the person is male.
During a hot July day, Brian and his friends play football outside. After a while, they are covered in sweat. Brian comments that sweat is just your body’s way of cooling itself. Which systems are involved in your body attempting to maintain homeostasis during high temperatures?
a. Your nervous system sends signals to your muscular system.
b. Your circulatory system gives blood to your respiratory system.
c. Your muscular system attempts to cool your skin through radiation.
d. Your excretory system attempts to cool your skin through evaporation.
Answer: B is correct I had this question too!
Similarly, the cardiovascular, integumentary (pores and skin and related structures), respiratory, and muscular structures paintings collectively assist the frame preserves a strong inner temperature. If frame temperature rises, blood vessels withinside the pores and skin dilate, permitting extra blood to waft close to the pores and skin's surface.
The temperature in the frame varies; in a frame in homeostasis (regular fitness state), the 'core' temperature is maintained inside quite a number 36-37.5.
What is Homeostasis?Homeostasis via way of means of contracting to show chemical electricity into thermal electricity if the frame is cold, it additionally facilitates to preserve homeostasis via way of means of contracting extra or much less frequently so oxygen can get to all cells from the heart.
Thus it is clear that systems are involved in your body attempting to maintain homeostasis during high temperatures your muscular system attempts to cool your skin through radiation.
To learn more about homeostasis refer to the link :
https://brainly.com/question/1046675
Activated complement brings about the death of a microbe when it _______________.
A. organizes into a membrane pore and causes lysis of the cell
B. mediates interactions between immune cells
C. activates a chemotaxic response in certain phagocytic cells
D. all of the above
Answer:
C
activates a chemotaxic response in certain phagocytic cells
Explain why flask #2 (yeast with glucose) produced more CO2 than flask #5 (yeast with flour). AND how did you know it produced more CO2?
Answer: Glucose
Explanation:
The carbon dioxide produced in the experiment can be directly related to the energy generated after the fermentation process. The carbon dioxide is the byproduct of the chemical reactions in the ethanolic fermentation. Glucose substrate will yield the highest energy along with the highest producer of the carbon dioxide after the fermentation process conducted by yeast as compared to the fermentation process that was conducted by yeast with flour. The flour will offer a source of carbohydrates including starch and sugars. The yeast will find out sugar in the flour and ferment it. Glucose is readily available sugar for the action of yeast so more production of carbon dioxide is expected from glucose substrate.
HELPPPPP ME PLS lol lol lol lol
Answer: 1. chemical weathering
2. mechanial weathering
3. Chemical weathering
4. I believe mechanical??
If theses are not right, I'm sorry for the wrong answers
Explanation:
Answer:
I dont even know-
Explanation:
You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.
Answer:
C is the best answer
Explanation:
the dominate trait is in 3 of the four boxes
There is a 75% chance that each offspring will be tall. Therefore option C is correct.
When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.
The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.
The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.
Therefore option C There is a 75% chance that each offspring will be tall is correct.
Know more about genotype:
https://brainly.com/question/31515990
#SPJ5
3. Which type of heat transfer causes your face
to feel warm when you sit in the Sun?
SC.7.P.11.4
A conduction
6 convection
© insulation
O radiation
A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll
Answer:
GL Gl gL gl
Explanation:
Why does a mountain create a rain shadow on the other side of a mountain?
Answer:
I hope this will help u
Explanation:
A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow
fill in the blanks to complete the concept map for the process of translation
Answer:RNA code for Amino Acids that make Proteins through the process of translation
Explanation:
During translation, tRNA recognizes the mRNA codons, complements them, and add the correct amino acid to the growing protein. CODON and PROTEIN are the missing words.
--------------------------------------------------------------------------
Protein synthesis
Occurs in two steps. Transcription and translation.
Transcription ⇒ mRNA syntheis
The first step before protein synthesis begins is to synthesize messenger RNA, mRNA.
This is the coping process of the DNA section for the desired protein, and it happens in the nucleus.
Translation:
⇒ Cytoplasm stage
• Translation takes place when the formed mRNA moves to the cytoplasm through the nucleus membrane pores.
• Once in the cytoplasm, mRNA meets a ribosome, which is the primary structure for protein synthesis.
• Ribosomes are organelles composed by the association of proteins with rRNA and tRNA. They can be found in the rough endoplasmic reticulum or floating in the cytosol.
• While the ribosome reads mRNA strain from its 5´ extreme to 3´, tRNA adds the correct amino acids to build the polypeptide.
→ mRNA is composed of different codons.
→ Each codon is a chort sequence of
three nucleotides that codes for one amino acid.
→ When tRNA molecules recognize these
sequencies, they add the correct amino
acid to the growing protein.
⇒ Protein synthesis ends when the proteins passes through the Endoplasmic Reticulum and the Golgi complex for their final folding process.
---------------------------------------------------------------
Related link: https://brainly.com/question/4161465?referrer=searchResults
If two parents have type O blood, what are the possible blood types of their children?
Answer:
O
Explanation:
It would be type O, because both parents have type O. Whether it was positive (+) or negative (-) would depend on both parents.
can you please answer these questions for me I really need help I am begging you
Answer:
1: 75%
2: 75%
3: 50%
4: 25%
Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?
Answer:The two processes are CONDUCTION and CONVECTION
Explanation:
The Energy produced in the Earth core is generated by Sun, gravitational force , radioactive decay, and the Earth' rotation, To maintain balance in the earth, The processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of tectonic plates at a constant rate.
Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous transfer of heat energy from the warmer mantle at the bottom to the cooler mantle at the top While Convection currents in the core move thermal energy causing the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and creating a balance in the earth.
Answer:
Conduction and Convection
Explanation:
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
what is the definition of the earth's crust
Answer:
“Crust” describes the outermost shell of a terrestrial planet.
Earth's crust is generally divided into older, thicker continental crust and younger, denser oceanic crust. Earth has three layers: the crust, the mantle, and the core. The crust is made of solid rocks and minerals.
If a myostatin protein is not the right shape, it cannot fit correctly into a cells receptor true or false
Explanation: Myostatin (also known as growth differentiation factor 8, abbreviated GDF8) is a myokine, a protein produced and released by myocytes that acts on muscle cells to inhibit muscle cell growth. In humans it is encoded by the MSTN gene.[6] Myostatin is a secreted growth differentiation factor that is a member of the TGF beta protein family.[7][8]
Therefore, if the myostatin protein is smaller than a microorganism it would be able to fit into the receptor.
Also, it helps me out if I get brainliest because it makes me a higher rank
what type of organism is missing from the food web in question #8
Answer:
Algae
Explanation:
definition of compounds
Answer:
A material made up of two or more substances.
Example: H20 2 hydrogen 1 oxygen
Explanation:
Please give me BRAINLIEST and THANKS lol <(￣︶￣)>
In the space below, summarize the process of sexual reproduction in unicorns to explain how offspring are produced. Include and highlight the following terms in your summary: Diploid, Fertilization, Gametes, Haploid, Interphase, Meiosis
Answer:Sexual reproduction allows some of the genetic information from each parent to mix, producing offspring that resemble their parents but are not identical to them. In this way, sexual reproduction leads to variety in the offspring. Animals and plants can reproduce using sexual reproduction.
Why does sperm development occur in an external
structure of the body?
to give sperm easier access to the urethra
to allow easier blood flow
to manage sperm's temperature
to keep it separate from the rest of the body
DONE
Answer:
To manage sperm's temperature.
Explanation:
Because the testicles can move depending on heat. They come closer to the body in the cold, farther out in heat.
Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.
1. How are the bodies of the three animals similar to one another? How are they different?
2. What might these similarities suggest about the common ancestor of these organisms?
Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.
Explanation:
I am also trying to understand the 2nd question, but this is the answer to the 1st one.
A small population will most likely
a. have plenty of food to eat. b. have exponential growth.
c. have plenty of space to live. d. All of these are correct.
Answer:
D. All of these are correct.
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225