Plato believed that knowledge of reality is grounded in knowledge of __________.

Answers

Answer 1

Answer:

For Plato, the Forms are the metaphysical foundation of reality, which means that knowledge of reality is grounded in knowledge of the Forms.

Explanation:


Related Questions

who is the 3rd president

Answers

Thomas Jefferson was the third president of United States.

Answer:

Thomas Jefferson

Explanation:

Choose the statement that CORRECTLY describes a part of the French and Indian War.

A. It was part of a conflict that took place on more than one continent.

B. The British believed France was encroaching on French territory.

C. The war was ended by the Treaty of Spain.

D. The French were able to prevent the British from taking major forts in Canada.

Answers

Answer:

A

Explanation:

It was part of a conflict that took place on more than one continent.

What is situational irony?

Answers

Answer:

situational irony is noun irony involving a situation in which actions have an effect that is opposite from what was intended so that the outcome is contrary to what was expected.

The United States played a worldwide active role to help stop the spread of communism after World War II.

Answers

what is the question though

In the 1920s, how did manufacturers reach large populations of people to encourage them to buy their products?

mass advertising
mass production
installment plans
none of the above

Answers

Answer:

Mass Advertising

Explanation: As you can see in the image I've attatched

Have a Nice rest of your day

April 21 is often a holiday in Texas. It is San Jacinto Day. What important event happened on San Jacinto Day? A) It marks the day Texas became a state. B) It marks the birth of Texas' first governor. o It marks the beginning of the Texas Revolution. D) It marks the last battle of the Texas Revolution.​

Answers

Answer:

A) it marks the day Texas became independent from Mexico.

Explanation:

Answer:

The correct answer is, It marks the beginning of the Texas Revolution so C.

Explanation:

San Jacinto Day is the celebration of the Battle of San Jacinto on April 21, 1836. It was the final battle of the Texas Revolution where Texas won its independence from Mexico.

Brainliest PLZ HELP IM TIMED

Answers

Answer:

-3.5

................

summary of if beale street could talk

Answers

Answer:

In early 1970s Harlem, daughter and wife-to-be Tish vividly recalls the passion, respect and trust that have connected her and her artist fiancé Alonzo Hunt, who goes by the nickname Fonny. Friends since childhood, the devoted couple dream of a future together, but their plans are derailed when Fonny is arrested for a crime he did not commit.  ; D

What is nationalism? (PS, I'm going to search for plagiarism, so do NOT copy & paste) (Double PS, I'll give Brainliest for the best answer UwU)

Answers

Answer:

nationalism is the place where u are from. sometimes it could be from where youre parents are from. for example my parents are from cuba so that makes my nationalism cuban because of them.

Explanation:


Also known as CSI, technicians who collect and preserve evidence from a crime scene?

A. Psychiatry
B. Anthropologist
C. Evidence collection unit
D. toxicologist

Answers

Answer:

C

Explanation:

Answer:

Evidence collection unit

Explanation:

Hope this helps

Why were Cuba,Haiti, and the Dominican Republic vital to emerging American power in the Caribbean

Answers

Answer:

The Dominican military went through moderate change, and its most obstinate components were dispatched abroad, regularly on imaginary political missions. In spite of destitution and hardship, the change toward popular government proceeded.

Haitian powers mounted close constant attacks against its neighbor all through the 1840s and 1850s. Out of irritation and dread, one venturesome Dominican president hit upon the ideal arrangement: he restored his nation to Spain, which continued frontier rule from 1861 to 1865.

This activity incited severe dissent in Haiti, uneasy about Spanish force, and in the US, shocked by quite an outrageous infringement of the Monroe Convention.

As in Cuba, American speculators started demonstrating interest in Dominican sugar when the new century rolled over. U.S. military intercession from 1916 to 1924 fixed this two-sided relationship. Before the finish of the occupation, two American aggregates possessed eleven out of the 21 ingenious (factories) in the nation and five of the others were claimed by U.S. residents.

Explanation:

There can be hazard in nearness to the US. Alongside Mexico and Focal America, islands of the Caribbean have shared this obvious reality. Through exchange, venture, intrusion, and tact, the US applied exceptional impact over patterns and occasions here all through the 20th century. Along with Focal America, investigation of the Caribbean gives significant point of view on difficulties confronting the district all in all and on the multifaceted nature of between American undertakings.

The problems caused by the showed the
Founders the need for a strong executive to respond to problems, enforce laws, and carry out the
acts of Congress.

Answers

Answer:

Founders the need for a strong executive to respond to problems, enforce laws, and carry out the

acts of Congress.

Explanation:

Answer: so you need to either one make a like a club or making robots to help

Explanation:

Mr. Quinn bought a new computer system. The regular price was $1580, but he got a 15% discount. How much did he pay? *

Answers

Answer: 1343

Explanation: 15% of 1580 = 237

1580-237=1343

Why are people convicted of a crime given prison sentences?



Choose all answers that are correct.


to protect the civil rights of criminal defendants


to serve as a warning to others


to protect society


to punish the person

Answers

Answer:

To punish the person and to serve as a warning to others.

Explanation:

First, they serve the goal of deterring future crime by both the convict and by other individuals contemplating a committal of the same crime. Second, a sentence serves the goal of retribution, which posits that the criminal deserves punishment for having acted criminally.

What is the system of checks and balances designed to ensure?
A
Foreign countries cannot meddle with US domestic affairs.

B
Power is not concentrated in one branch of government.

C
Citizens are not taxed without receiving representation.

D
Civil liberties are not violated by the federal government.

Answers

Answer:

The answer to this question is B

Which statement BEST describes the Bolshevik Revolution?
es
A)
It was begun by Joseph Stalin.
B
It began a civil war in Russia.
It toppled Tsar Alexander II from power.
D)
It prevented Russia from exiting World War I.

Answers

B because after the Bolshevik revolution, there was a civil war between the Bolsheviks and the White Movement (and some other minor factions like anarchist Ukraine and the green peasant armies)

As part of Washington's foreign policy, he stated that America would stay out of European conflicts and not choose sides. Which event of his presidency is this referring to?

Group of answer choices

A. Jay's Treaty

B. Proclamation of Neutrality

C. Treaty of Greenville

Answers

It's B. Proclamation of Neutrality

What did peter the great make the nobles do to make them look more westernized?

Answers

Answer:

Peter's internal policy served to protect the interest of Russia's ruling class—the landowners and the nascent bourgeoisie. The material position of the landed nobility was strengthened considerably under Peter. Moreover, the status of the nobility was modified by Peter's Table of Ranks (1722). ...

Explanation:

Main Idea/ Message / Important details represented by the image and Did America fulfill the dreams of immigrants in the late 1800s? ​

Answers

Answer:

The American Dream did come true for immigrants in New York because they were able to get jobs and their lives improved. The American Dream did come true for immigrants because they were able to escape the problems in their homelands and have a new start.

Explanation:

In The American Dream

In what way did George III impact the British government?

Answers

Answer: (1738-1820) the longest reigning monarch in British history, ruling at a time when Britain and France struggled to dominate Europe; he shared the blame for the loss of Britain's colonies

Explanation:

Answer:

He tried to make Parliament bend to his will.

Explanation:

Jesus promised that the Word of God, including the Psalms, would be preserved. True False

Answers

Answer: true

Explanation:

The answer is true....

What caused more deaths than the war itself?

Answers

I need more context , if it has to do with WW1 I’d say the Spanish Flu

Answer:

disease

Explanation: the new places that war brings you to their are new viruses that you can die from like when the eouropeans brought the diseas they were imune to, and  infected the indians of the new world. mainly from lack of immunitey


(a) Briefly explain ONE major difference between Wilentz's and Hahn's
historical interpretations of Manifest Destiny

Answers

Answer:

Wilentz considers that Manifest Destiny was democratic in certain moments. While Hahn believes that Manifest Destiny had imperialist concepts of control.

Explanation:

Wilentz considers that the Manifest Destiny had a democratic nature, most of the time, since the Ameiran empire considered implementing its concepts in the regions it dominated, so, since the USA was democratic, so was the Manifest Destiny presented an ambivalent nature, where democracy was sometimes not respected.

Hahn, on the other hand, believed that Manifest Destiny was imperialistic in nature and arose out of a desire to provoke in other regions, which the English colonists did in America.

One major difference that lies in the interpretation of these two person's is that Hahn saw the manifest destiny policy as an injustice that the settlers committed while Wilentz saw it as a rise to the democracy in the US.

According to Wilentz, the manifest destiny was the Americans trying to implement their concepts in the new areas that they now dominated. Wilentz absolved the US of blame because he felt that Americans had to ensure that democracy was respected.

According to Hahn the manifest destiny was not different from what the Europeans did to the settlers. He argued that the idea was out of the need to provoke and take from others. He called it imperialistic.

Read more on https://brainly.com/question/20373413?referrer=searchResults

Which is an example of objectification?
A. A song about slaves wanting to be free from their masters
B. A story about a revolt on a ship that is carrying slaves from one continent to another
C. A movie about slaves being happy to serve their wealthy masters serverheir
D. All of the above

A pe x Answer: C​

Answers

Answer:

D

Explanation:

the answer is b because objectification is the act of treating a person or sometimes an animal as an object or thing so when the slaves are being shipped from place to place like cargo, this shows them being treated as if they are not human

Help me plsss I need help

Answers

It's C imperialism ………………………………

Do this for brainliest

Answers

Answer:

Ok

Explanation:

BRUH

Which appeal is the best example of logos?

Answers

Answer:

A good logo is distinctive, appropriate, practical, graphic and simple in form, and it conveys the owner's intended message. ... A logo should be able to be printed at any size and, in most cases, be effective without color. A great logo essentially boils down to two things: great concept and great execution.

Tips:

Simple. Many of the most impactful and successful logos in history are surprisingly simple.

Relevant

Memorable

Timeless

Versatile

Hope this helped! :)

Answer:

Statistics show that the new tax is likely to affect families

Explanation:

A p e x just did it

why was queen nanny regarded as a myth

Answers

Answer:

Because she saved so many lives it was like she did the impossible saving slaves.

Explanation:

How does paragraph 6-7 contribute to the development of the ideas in the text ?

Answers

Answer:

send me the link to the question

What did King George III place in the colonies without their permission even during times of peace?HELPP

Answers

Answer:

British troops

Explanation:

George Grenville believed the colonists should pay for the British troops who defended them during the war. The British government had to deal with a huge war debt after the French and Indian War.

Hiya!!

The answer is British troops! <3

Other Questions
what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope. 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. how do you solve 2x plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec Community health problems can be addressed through the provision of health education. Justify it Moritz rescued his friend from a dangerous ocean rip current by pulling his friend from the water. Which activity most likely prepared him for this?enrolling in a class about swimming safetytaking a CPR training classwatching online shows about being a lifeguardtalking with friends who are lifeguards 2000x5000000000000000000000000000 PLEASE HELP Write the point-slope form of the equation of the line through the given points.3) through: (4, 5) and (0, 2) in having trouble can someone help me please