Our biggest loser went from 403lbs to 288lbs. He lost a total of 215lbs. Explain what happened to the 215lbs. Be sure to discuss what he did, the process(es) that took place, the type of matter he lost, and the type of matter he lost it as.

Answers

Answer 1

Answer:

Explanation:

Weight on a human body is mainly stored as muscle or fat. When we exercise we don't necessarily lose fat. Instead, the fat cells tend to shrink in size but remain the same amount. Fat is converted into energy which the body uses to function. This energy is expelled from the body in many different forms such as carbon dioxide and sweating. Therefore those are the matter that the individual in question lost when losing the 215lbs


Related Questions

Help!! Please!! I'll name you brainliest!!

Answers

Explanation:

the same as the charge on the ion.+1 +2-2

5. -1

plz mark my answer as brainlist plzzzz you get it helpful ☺️.

Hope this will be helpful to you.

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

Which answer choice accurately depicts the sequence by which blood moves from the pulmonary vein to the body tissues?

Answers

Answer:

See the answer below

Explanation:

Oxygen-rich blood flows from the lung through the pulmonary vein to the left atrium of the heart. From there, the blood is pumped through the mitral valve to the left ventricle. The contraction of the left side of the heart sends the oxygenated blood out of the left ventricle through the aortic arch to the major arteries designated to carry blood to the major parts of the body. From the arteries, blood moves to the capillaries and then to the various tissues of the body before returning back to the heart through the vein.

Thus, the sequence of flow of blood from the pulmonary vein to the body tissues can be summarized as:

Pulmonary vein -> Left atrium -> Arteries -> Capillaries -> tissues

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

Put "Sympatric Speciation" in a sentence

Answers

Answer:

A 2008 study suggests that sympatric speciation has occurred in Tennessee cave salamanders.

Explanation:

Hope this helps

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

In a sex linked trait, the recessive phenotype is most often found in males because...

Answers

Answer:

X-linked recessive diseases most often occur in males. Males have only one X chromosome. A single recessive gene on that X chromosome will cause the disease. The Y chromosome is the other half of the XY gene pair in the male.

Explanation:

Why are you learning this stuff anyways.Girl????????

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

In this food web, birds would be classified as
A)
carnivores.
B)
decomposers.
herbivores.
D)
omnivores.

Answers

Answer:

D)  omnivores.

Explanation:

The bird consumes both plants and arthropods

Answer:

omnivores

Explanation:

omnivorous consumers. they eat other animals like snails and worms but they also eat berries.

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

What happened at point B? Why?

Answers

Answer:

population has decreased over that period ,MAyBe

Explanation:

I don't know why

Why would cells from the same organism have different functions?

Answers

Answer:

Explanation: Cells have to fulfill multiple different functions to be able to build complex multicellular organisms. Differently expressed genes lead to different proteins made in the cell, which leads to different morphology, shape or function. ... When this factor cannot be expressed, these cells do not develop at all.

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

Construct Explanations Based on evidence from your model, explain how hotspot volcanoes change Earth's surface. When there are tectonic plates

Answers

Answer:

High heat and lower pressure at the base of the lithosphere (tectonic plate) facilitates melting of the rock. This melt, called magma, rises through cracks and erupts to form volcanoes. As the tectonic plate moves over the stationary hot spot, the volcanoes are rafted away and new ones form in their place.

Explanation:

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

When organisms

they increase in size.

Answers

Answer:

The increase in size and changes in shape of a developing organism depend on the increase in the number and size of cells that make up the individual. Increase in cell number occurs by a precise cellular reproductive mechanism called mitosis.

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

B cells can divide to form plasma cells. Each plasma cell contains many mitochondria
and an extensive endoplasmic reticulum. Referring to the function of plasma cells in your answer, explain why these features are important adaptations.

Answers

Answer:

Explanation:

The presence of mitochondria  and an extensive endoplasmic reticulum are the features that are important for adaptations of the plasma cell because plasma cells (white blood cells) secrete immune proteins also called antibodies which only formed due to the presence of endoplasmic reticulum whose function is to formed proteins for the cell so that's why plasma cells have large sized endoplasmic reticulum.

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

PLS HELP ASAP!!!!!!!

Answers

Answer:

3. A and B are true

4. oxygen, photosynthesis, I think oxygen, cellular respiration

Explanation:

Hope this helps! :) I am think all of my answers are correct.

which part of the eye is sensitive to light?

Answers

Which part of the eye is sensitive to light?

Retina

sorry kalo salah

To ligth The sensitive of teh eye

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make
Other Questions
create two stanza poem that will inspire the community to recognize the importance of categories of tropical cyclones. Give your poem a title 8. a) How are the events in the menstrual cycle triggered by the body? (1 point)Will be marking brainliest!! What is the sum? A, B, C, D I need help with this question plz help me huryyyyyyyyy How would you write out "The quotient of a number decreased by 7 and -2 is -10" Raina picks 20 flowers1/4 are roses 2/5are daisiesHow many flowes are lilies? this is a yes or no question... if a box has equal and opposite forces acting on it, will the box be accelerate?? Select one of the readings in this unit and in at least 150 words, discuss the author's use of figurative language, alsoknown as Sgures of speech, Iterary devices, and thetorical devices. Identify and discuss the explicit and implicitmeaning of at least three kinds of figures of speech(please please please help me)don't answer if you don't know, i'll mark you as brainly if you answer this for me. Find the length of the third side. If necessary, write in simplest radical form If you could meet anyone from the past or present, who would youlike to sit down and talk to? Explain why. II- Encuentra en la sopa de letras 8 pares de palabras terminadas en "z y en 'ces". Escrbelespor pareja en los recuadros:ayuda plis son 16 palavaras ayuda :) Calcule how long it takes a sound wave to travel trough 1.0km of water at 0C need help please will mark you brainliests please give reason to 50% of 25% of a number x isA- one eighth of XB- half of XC- one fourth of XD- three fourth of X please urgent please help Find the tangent of the larger acute angle in a right triangle with side lengths 3, 4, and 5. Write your answer as a fraction THEY ARE REAL- PLEASE THEY ARENT FAKE Find the area of the figure below. 7 cm just need to know the fraction