On a nongovernmental, not-for-profit entity's statements of activities, which of the following amounts should not be netted together under any circumstances?
A. Revenues and expenditures from the sale of used equipment.
B. Revenues and expenditures from an annual fundraising event representing a major source of revenue.
C. Investment income, custodial fees, and other advisory expenditures.
D. Gains and losses from exchange rates or other foreign currency translations

Answers

Answer 1

On a nongovernmental, not-for-profit entity's statements of activities, B) revenues and expenditures from an annual fundraising event representing a major source of revenue should not be netted together under any circumstances.

It is important to note that on a nongovernmental, not-for-profit entity's statements of activities, revenues and expenditures from an annual fundraising event should never be netted together.

This event is typically a major source of revenue for the organization and should be accounted for separately.

All revenue should be reported separately from any related expenditures, ensuring accurate financial reporting.

The annual fundraising event of a nongovernmental, not-for-profit entity is a major source of revenue and should never be netted together on the organization's statements of activities.

It is essential to clearly distinguish between income and expenses from this event in order to accurately represent the financial position of the organization.

To learn more about revenues, click here:

https://brainly.com/question/8645356

#SPJ4


Related Questions

question mode multiple choice question municipalities have adapted to increased diversity in their populations by: multiple choice question. reducing services to all creating separate facilities for those who don't speak english changing their tax structures to include illegal immigrants adding languages other than english to their signs and websites

Answers

Municipalities have adapted to increased diversity in their populations by adding languages other than English to their signs and websites. So option d. is correct.

Most Americans have more regular touch with their State and local governments than with the Federal Government. Police actions, libraries, and academies - as well as driver's licenses and parking tickets - generally fall under the management of State and local governments. Municipalities normally take responsibility for gardens and recreational assistance, police and fire divisions, housing services, municipal courts, and general works like roads, sewers, etc.

To learn more about the municipality visit here:

https://brainly.com/question/3226540

#SPJ4

z is a normal good. the equilibrium price and quantity of z in the year 2011 was $25 and 60 units, respectively. in 2014, the equilibrium price of z had increased to $35 and the equilibrium quantity had increased to 70 units. other things remaining the same, which of the following could explain this change?

Answers

An increase in the demand for z, could explain this change as the equilibrium price and quantity of z in the year 2011 was $25 and 60 units, respectively.

What is meant by equilibrium quantity?

If a product is available in the market in an equilibrium quantity, there is neither a shortage nor an oversupply. When demand and supply are in balance, the amount of a good that customers want to buy and the amount that its suppliers are able to supply, the two are said to be intersecting.

The only price at which consumer and producer plans can be reconciled is the equilibrium price, which is reached when the quantity of the good that consumers wish to purchase, or quantity requested, equals the quantity that producers wish to sell, or quantity supplied. The term "equilibrium quantity" refers to this universal quantity.

The equilibrium price will drop with a drop in demand, and supply will increase less than demand. The equilibrium price will decrease with an increase in supply while the quantity required will rise, all other factors being equal. The equilibrium price will increase with a drop in supply, but the amount required will go down.

Shift of the demand curve for Z to the right

To learn more about equilibrium quantity refer to;

brainly.com/question/28895169

#SPJ4

Thus the complete question is:

z is a normal good. the equilibrium price and quantity of z in the year 2011 was $25 and 60 units, respectively. in 2014, the equilibrium price of z had increased to $35 and the equilibrium quantity had increased to 70 units. other things remaining the same, which of the following could explain this change?

A) An increase in the price of a substitute good.

B) An increase in the demand for z.

C) A decrease in the supply of z.

D) An increase in the price of z's complement good.

a registered investment adviser that trades securities on the behalf of customers is required to keep a record of the transaction that includes all of the following information except the name of the: a investment adviser representative (iar) who placed the order b broker-dealer to which the order was sent for execution c person at the investment adviser who recommended the transaction d agent at the broker-dealer who executed the transaction

Answers

All of the following information, with the exception of the name of the agent at the broker dealer who carried out the transaction, must be included in a record of the transaction kept by a registered investment adviser that trades securities on behalf of clients. Option D.

What is an investment adviser?Someone or a business that receives compensation for advising customers on investments is known as an investment adviser. Investment advisers and financial advisors are two different professions, despite the fact that the words sound identical. A company registered with the Securities and Exchange Commission or a state's securities commission as an investment adviser in the United States is known as a registered investment adviser. A financial advisor often charges 1% of the assets they are managing as their fee. However, the cost gets smaller as your investment amount increases.Investment advisors concentrate on assisting you with investing, as opposed to financial planners, who concentrate on things like estate planning, retirement planning, and more.

To learn more about investment adviser refer to:

https://brainly.com/question/20383921

#SPJ4

ABC company received $9,631 for its 5-year, 10% bonds with a total face value of $10,000. The market rate of interest was 11%. The bonds pay interest annually on December 31. Approximately how much interest expense will ABC Corporation record on the second annual interest payment date using the effective-interest method?

Answers

The interest expense for the second annual interest payment date using the effective-interest method is $950.

The effective-interest method is used to calculate the interest expense that a company records on its financial statements over the life of a bond. This method takes into account the fact that the bond's value changes over time as interest rates change, and it allocates the bond's discount or premium over the life of the bond.

To calculate the interest expense for the second annual interest payment date, first, we need to find the carrying value of the bond at the beginning of the year.

Carrying value = bond's face value - bond's discount.

The bond's discount = (market rate - bond's coupon rate) x bond's face value x time to maturity.

In this case, the bond's discount = (11% - 10%) x $10,000 x 5 = $500. Therefore, the carrying value of the bond at the beginning of the year is $9,500.

The interest expense for the second annual interest payment date is then the interest rate multiplied by the carrying value of the bond. The interest expense for the second year is 10% x $9,500 = $950.

Read more about Bond accounting:

https://brainly.com/question/7291563

#SPJ4

Under the authority of a federal voting rights statute, some states drew congressional districts in a manner calculated to increase the likelihood that members of historically disadvantaged minority racial groups would be elected. The U.S. Supreme Court declared these districts to be unconstitutional, as improper racial gerrymanders. In response to this ruling, Congress passed a new statute that explicitly denies the Supreme Court appellate jurisdiction over all future cases challenging the constitutionality of action taken under the authority of the federal voting rights statute. Which of the following is the most persuasive argument for the constitutionality of the new statute restricting the Supreme Court's appellate jurisdiction?
A: Article III of the Constitution explicitly states that the Supreme Court's appellate jurisdiction is subject to such exceptions and regulations as Congress shall make.
B: The constitutional principle of separation of powers authorizes Congress to pass statutes calculated to reduce the effects of Supreme Court decisions that interfere with the exercise of powers that have been delegated to the legislative branch.
C: The establishment and apportionment of congressional districts directly affect interstate commerce, and the Constitution authorizes Congress to use its plenary authority over such commerce for any purpose it believes will promote the general welfare.
D: The Fifteenth Amendment authorizes Congress to enforce the amendment's voting rights provisions by appropriate legislation, and Congress could reasonably determine that this restriction on the Supreme Court's appellate jurisdiction is an appropriate means to that end.

Answers

Article III of the Constitution explicitly states that the Supreme Court's appellate jurisdiction is subject to such exceptions and regulations as Congress shall make.

What is meant by Supreme Court's Appellate Jurisdiction?

We are the final court of appeal in civil and criminal cases from England, Wales, and Northern Ireland in the United Kingdom. Cases with the greatest public or constitutional significance that have an impact on the entire population are heard by the Supreme Court.

Almost any other case involving a point of federal or constitutional law falls under the appellate jurisdiction of the Court, which means that the Court can hear the case on appeal.

Regardless of whether the alleged violations involve the federal, state, or local governments, cases involving alleged violations of federal constitutional rights are subject to the jurisdiction of U.S. appellate courts.

Typically, an application to the Supreme Court is required to appeal. A three-member "Appeals Committee" of Supreme Court Justices will decide whether to allow an appeal.

To know more about Justice, visit:

https://brainly.com/question/9003956

#SPJ4

Which of the following are reasons why a marketing class is important to all students, regardless of major?
1. no matter what job you have, you will probably have to do some marketing
2. when you look for a job, you are marketing yourself
3. it will help you as a consumer, to make better purchase decision

Answers

A marketing class is important to all students, regardless of major because 3. it will help you as a consumer, to make better purchase decision.

Marketing studies help you develop critical thinking skills. The students obtain exceptional skills in data interpretation and higher-level thinking, allowing them to translate analytics into strategy.

Learning about marketing will help you understand what motivates a company. You will get experience as a strategic and creative problem solution. Communication and negotiation abilities are essential in all corporate functions.

Every professional path entails some form of business communication. Every firm need professionals who can successfully communicate with management, the audience, stakeholders, and customers.

Learning marketing will help you develop important communication and negotiation skills that you can apply in your personal and professional life. It can educate you how to employ analytical thinking and persuasive arguments to accomplish your objectives swiftly and efficiently.

To know more about marketing:

https://brainly.com/question/27155256

#SPJ4

If you are entering a cell address in to Excel for cell F26 and you want to copy the formula that contains this address and have the row update, but the column stay locked, Which of the follow is correct?
A. F26
B. F$26
C. $F$26
D. $F26

Answers

Use $F26 If you are entering a cell address in to Excel for cell F26 and you want to copy the formula that contains this address and have the row update, but the column stay locked,

What is Cell Address in Excel?

The Excel Lookup and Reference functions subset include the cell ADDRESS Function. By using the row number and column letter, it will give a cell reference (its "address"). A text string containing the cell reference will be given.

The function can be used to create a cell reference inside of a formula and can return an address in either a relative or absolute format. As a financial analyst, you can change a column number into a letter by using the cell ADDRESS. The function can be used to address either the first or last cell in a range.

To learn more about cell addresses visit;

brainly.com/question/29369520

#SPJ4

the following items would be included in the factory overhead section of the schedule of cost of goods manufactured: (check all that apply.) multiple select question. factory supplies used factory insurance direct labor factory utilities direct materials

Answers

The following items would be included in the factory overhead section of the schedule of cost of goods manufactured are:

factory supplies used factory insurance direct labor factory utilities

Definition of Factory Overhead Cost

Factory overhead costs are a type of expenditure that is not directly related to the production process of goods or services.

Generally, these costs are owned by each company and come from the production support division within the company.

Examples of factory overhead costs, such as costs for additional facilities in the production process, insurance costs, taxes and much more.

Even though it is not directly related to production, the business can continue to operate, one of which is with this cost.

Therefore, It must still be budgeted by each company.

Factory Overhead Cost Grouping

Every company or factory, of course, has a business budget plan. Making a budget is easier and more automatic using the rab application.

To make the process easier, one of them is by classifying overhead costs.

Overhead costs are grouped into three different parts with various constituent elements. The following are the elements of factory overhead costs in each group.

By Nature

Overhead costs in a factory or company, according to their nature are divided into three different elements, namely:

Cost of supporting or auxiliary materials. That is, this material is not a result of production or a material whose value is less than the price of the entire product Costs for indirect labor, namely labor whose nominal wages cannot be calculated directly from production results Care/maintenance costs, such as the cost of repairing production equipment, vehicle repairs or the cost of purchasing spare parts.

Learn more about factory overhead at

https://brainly.com/question/14256382.

#SPJ4

Mary Smith, a resident of Denver, Colorado, purchases a Swiss watch in Chicago. On the U.S. balance-of-payments statement, this transaction appears on the
a) current account.
b) net borrowing and lending account.
c) services account.
d) official reserve asset account.

Answers

Mary Smith, a resident of Denver, Colorado, purchases a Swiss watch in Chicago. On the U.S. balance-of-payments statement, this transaction appears on the current account. The correct answer is a.

When Mary Smith purchases a Swiss watch in Chicago, it is considered a trade in goods transaction. The current account in the balance of payments statement records all transactions involving the trade of goods and services, as well as income flows, between a country and the rest of the world.

In this case, Mary is traveling to Chicago and purchasing a Swiss-made watch, which is a trade in goods transaction between Switzerland and the United States. This transaction would be recorded on the U.S. balance-of-payments statement's current account, which records all trade in goods transactions between the U.S. and other countries. The current account balance is a measure of a country's net international transactions and can be in surplus or deficit.

To learn more about current account visit: https://brainly.com/question/22333470

#SPJ4

candy entered into a valid, binding contract to purchase a car from dave the dealer for $22,000. candy paid dave in cash for the car, which was a standard new model suv. when candy came to take delivery, dave refused to give her the suv, violating the terms of their contract. he offered to give her back her money and pay her an extra $100 for her trouble and expenses driving to and from the dealership, and this would have fully compensated her for what she was out, but candy waned the suv. if candy makes request to the court for dave to turn over the suv, the court will grant this remedy, known as specific performance.

Answers

If candy makes request to the court for Dave to turn over the SUV, the court will grant this remedy, known as specific performance. (True)

What is an specific performance?

Specific performance is an equitable remedy in contract law where a court orders a party to carry out a specific act, like finishing the contract's performance. In other cases, if damages are a better option, it is typically not available but is in the sale of land law.

For contracts involving personal services, specific performance is almost never possible, though performance can also be guaranteed by threatening legal action for contempt.

A type or subset of specific performance, an injunction is one of the more popular types of specific performance and is frequently used when it comes to private information or real property.

Learn more about Specific performance

brainly.com/question/28452554

#SPJ4

You see that First National Bank is willing to make you a four-year $40,000 car loan with an interest rate of 4.2%. However, the same bank will charge you 16.5% interest on a credit card that it issues. Why is the interest rate on the credit card so much higher than the interest rate on the car loan?

Answers

The interest rate on a credit card is typically higher than the interest rate on a car loan because credit card debt is considered to be unsecured debt, while a car loan is secured by the vehicle being purchased.

What is the interest rate?

Generally, This means that if the borrower defaults on the loan, the lender can seize the vehicle as collateral.

Additionally, credit card companies often have higher default rates, which means that they need to charge higher interest rates to compensate for the increased risk.

Furthermore, credit card companies also have higher overhead costs to cover than auto loan companies, which also contributes to the difference in interest rates.

Read more about interest rate

https://brainly.com/question/13324776

#SPJ1

the willingness of a consumer to give up consumption of one commodity (x) in exchange for an increase in some other commodity (y)

Answers

Marginal Rate of substitution  is the rate at which the consumer is willing to give up commodity ‘X’ for one more unit of commodity ‘Y’. He tries to develop the same level of satisfaction.

With an example, what is the marginal rate of substitution?

The amount of one good that a consumer is willing to give up in exchange for some amount of another good is known as the marginal rate of substitution. For instance, the MRS is -6 divided by 3 to get -3 if a consumer is willing to give up 6 bananas for 3 apples.

Marginal rate of substitution:

The rate at which a consumer can exchange some of one good for another with the same level of utility is known as the marginal rate of substitution in economics. Marginal rates of substitution are identical at consumption levels that are in equilibrium.

What is the formula for the marginal rate?

You always have the option of calculating your tax in either direction, taking into account or excluding the anticipated income from the proposed investment. You can determine the economic marginal tax rate from investing by dividing the difference in tax by the amount of investment income.

Learn more about marginal rate of substitute:

brainly.com/question/20595808

#SPJ4

a building suffered uninsured water and related damage. the damaged portion of the building was refurbished with upgraded materials. the cost and related accumulated depreciation of the damaged portion are identifiable. to account for these events, the owner should

Answers

Capitalize the expense of renovation, and in the present period, record a loss equivalent to the carrying value of the building's damaged area.

Can the costs of renovation be capitalized?

A renovation or improvement project must meet three requirements in order to be capitalized: The project must cost more than $50,000. It must benefit the component in some way. It must increase the component's useful life.

Should I capitalize the expense of repairs and upkeep?

There are three "safe harbors," as the IRS refers to them, from the general rule that repairs and maintenance costs must be capitalized and depreciated. This basically indicates that if there are mitigating circumstances, you do not always have to abide by the rules.

To know more about expense visit:-

https://brainly.com/question/29842871

#SPJ4

futuretek technologies, inc. is analyzing a capital project for producing a new type of project management software called futureplan. which of the following is an example of a sunk cost, and should it be included in the cash flows for capital budgeting?

Answers

Futuretek Technologies, Inc. is evaluating a potential capital investment in producing a new type of project management software called FuturePlan.

As part of the evaluation process, it is important to consider sunk costs, which are costs that have already been incurred and cannot be recovered.

An example of a sunk cost in this context would be the costs of research and development that were incurred prior to the capital budgeting process. These costs should not be included in the cash flows for the capital budgeting evaluation.

When analyzing the project for its potential success, it is important to consider the costs associated with it. One type of cost that should be taken into account is sunk costs, which are those that have already been incurred and cannot be recovered. Examples of sunk costs include research and development costs, advertising costs, and any other costs that have already been spent and cannot be recovered.

To learn more about capital, click here:

https://brainly.com/question/679709

#SPJ4

Which statement most accurately defines a marketing information system (MIS)?
A.
a structured, computer-based system that provides primary research information
B.
a structured, computer-based system that provides information about competitors
C.
a structured, computer-based system that provides secondary research information
D.
a structured, computer-based system that provides information about various business functions

Answers

A marketing information system, often known as MIS, comprises data collection, storage, and analysis to provide management with information about the products.

What would you say is marketing?

Marketing refers to a number of actions, institutions, and procedures with the goal of creating, communicating, delivering, and exchanging offerings that are beneficial to customers, clients, partners, and society as a whole. The four Ps stand for products, pricing, places, and promotions. They represent a "marketing mix," which is the combination of tools and strategies used by marketers to achieve their marketing objectives. The four Ps were first explicitly presented by E. in 1960.

Know more about management Visit:

https://brainly.com/question/29023210

#SPJ1

how would a government subsidy to help fund education for children of employees impact the supply for labor? select the correct answer below: the supply increases. the supply decreases. the supply does not change. the effect is unknown.

Answers

A government subsidy to help fund education for children of employees impact the supply for labor - the supply decreases.

The correct option B.

Governments may provide some businesses or economic sectors with subsidies in the form of cash, tax cuts, or other types of financial assistance.

The purpose of subsidies is to support or maintain what are seen as critical facets of the infrastructure or economy of a country.

Although the specific sector or firms involved may directly benefit from subsidies, economists contend that subsidies undermine free trade and lead to market inefficiencies.

Government subsidies help an industry by defraying a portion of the costs associated with producing goods and services through the provision of tax credits or reimbursements, as well as by defraying a portion of the costs associated with a customer's purchase of goods and services.

To learn more about Government subsidies, refer

https://brainly.com/question/29526404

#SPJ4

Miguel is planning a teleconference that involves people from New York, Los Angeles (three hours behind New York), and Paris (six hours ahead of New York). He wants to avoid making anyone participate when people in that time zone are typically asleep. When is the best time for him to plan this teleconference using New York (Eastern) time?

Question 2 options:

noon


6:00 p.m.


6:00 a.m.


4:00 p.m.

Answers

The best time for Miguel to plan the teleconference such that the time zone isn't typically asleep is A. Noon.

Why is Noon the best time?

If Miguel sets the teleconference using New York (Eastern) time at noon, then the time the people in Paris will attend is:

= 12 noon + 6

= 6 pm

The time that the people in Los Angeles will attend the teleconference using New York (Eastern) time is:

= 12 noon - 3

= 9 am

Both these times are times when people are not asleep and so this is the best time.

Find out more on time zones at https://brainly.com/question/9031806

#SPJ1

__________ occurs when people experience a gain or loss in position and/or income that does not produce a change in their place in the class structure.
A. Horizontal mobility
B. Structural mobility
C. Situational mobility
D. Vertical mobility

Answers

A. Horizontal mobility occurs when people experience a gain or loss in position and/or income that does not produce a change in their place in the class structure.

Social mobility is the movement of people within a system of social hierarchy or stratification. It is referred to as "horizontal mobility" if such mobility entails a change in position, often in occupation, but not in social status. A individual who transfers from a managerial position in one firm to one in a different would be an example. Vertical mobility, on the other hand, refers to a shift in social class and can be either "upward mobility" or "downward mobility." A landed aristocracy who loses everything in a revolution slides downward in the class system; an industrial worker who becomes a successful businessman advances.

To know more about Horizontal mobility:

https://brainly.com/question/14024615

#SPJ4

if a sole proprietor wishes to register with the state as an investment adviser, which of the following documents are required? i financial statement of the sole proprietor ii income statement of the sole proprietor iii an auditor's opinion that the document filed is true and current iv an affirmation made by the sole proprietor that the document filed is true and current

Answers

A sole proprietor must submit a financial statement and a statement from the sole proprietor stating that the information submitted is accurate and up-to-date in order to register with the state as an investment adviser.

Unincorporated businesses run by a single person are known as sole proprietorships. In several States, sole proprietors are eligible to register as a broker-dealer or investment adviser. Each sole proprietor applying for first registration shall submit to the Administrator an original statement of financial situation (a balance sheet) and an oath or affirmation by the sole proprietor that the financial statement is genuine and current.

Notably, the lone proprietor is not required to provide an income statement or financial statements that have undergone an audit.

Learn more about sole proprietor here:

https://brainly.com/question/14280034

#SPJ4

how does tesla cutting prices affect the economy i need help pls

Answers

It affects it because Tesla is a big company

nathan left frank's office unsure of what to do. frank, the managing partner of the firm, had just asked him to file a return for a major client improperly showing zero fines or underpayment penalties. this client was important to the firm, and especially to frank, who had a longstanding relationship with him.

Answers

Resisting authority (A person in authority makes a morally questionable request.)

Disrespect in the workplace can damage the manager's credibility and promote discord. One employee's opposition to authority might cause confrontations that stress and demoralize the whole team.

Unchecked resistance to authority can spread throughout a small organization, reducing productivity and turnover. Managers must first recognize authority resistance to address it.

Shortcomings in Individuals' Estimated Tax Payments. A penalty is assessed for underpayment or late payment of estimated income tax for individuals, estates, and trusts. Even if you are due a refund, you may still be subject to the fee.

To know more about underpayment penalty:

https://brainly.com/question/29317255

#SPJ4

The right way of asking the question is:

Nathan left Frank's office unsure of what to do. Frank, the managing partner of the firm, had just asked him to file a return for a major client improperly showing zero fines or underpayment penalties. This client was important to the firm, and especially to Frank, who had a longstanding relationship with him.

suppose that consumers purchase fish and computer chips. in 2010, 1 pound of fish cost $1, a computer chip cost $1, and the typical consumer bought 10 pounds of fish and 10 computer chips. in 2011, 1 pound of fish cost $2, a computer chip cost $0.50, and the typical consumer bought 5 pounds of fish and 20 computer chips. in 2012, 1 pound of fish cost $2.10, a computer chip cost $0.90, and the typical consumer bought 12 pounds of fish and 20 computer chips. using 2011 as the base year, the inflation rate between 2011 and 2012 is percent.

Answers

The inflation rate between 2011 and 2010, using 2010 as the base year, is 25%.

What is the inflation rate right now?According to U.S. Labor Department data released Jan. 12, the country's annual inflation rate decreased from 7.1% to 6.5% for the year ending December 2022. On February 14, 2023, at 8:30 a.m. ET, the following inflation update is expected to be released. The US inflation rate is at 6.45%, down from last month's 7.11% and from this year's 7.04%. This is greater than the average over the long run of 3.27%. Consumer prices increased by 9.1% over the year ended in June 2022, the most in 40 years: United States Bureau of Labor Statistics, The Economics Daily. December saw a sixth straight month of declining annual inflation, which came in at 6.5%. By the end of 2023, the annual rate is most expected to be 3.2% due to the economy's declining growth. As a result of the fact that this will still be higher than the Federal Reserve's goal range of 2-2.5%, the Fed decided against lowering short-term interest rates this year.

To learn more about inflation rate, refer to:

https://brainly.com/question/29230049

#SPJ4

Which of the following are venture types that allow an entrepreneur to pursue their mission or vision?
earning income to meet a personal need
tax exempt status to solve a governmental problem
a nonprofit social enterprise for the environment
a hybrid political action committee

Answers

a nonprofit social enterprise for the environment are venture types that allow an entrepreneur to pursue their mission or vision.

The term "environment" may be used to refer to the whole of all living and non-living things as well as their influences on human life. The term "natural environment" or "natural world" refers to all naturally existing, that is, unman made, living and non-living phenomena. The present value analysis phrase is most frequently used to refer to the Earth or specific regions of the Earth. An ecosystem is a natural system made up of all the living organisms plants, animals, and microorganisms as well as all the inanimate objects that make up the environment. The four fundamental elements of the environment are the lithosphere, which consists of rocks and soil, the hydrosphere, which consists of water, and the biosphere, which consists of living things.

learn more about present value analysis here

https://brainly.com/question/29562042

#SPJ4

fill in the blank. the brown company follows a market-oriented approach, whereas the columbia company believes in a sales-oriented approach. considering their approaches, it is evident that___has/have an advantage in today's marketplace because it/they finds/find out what customers want and what they need.

Answers

It is evident that Brown company has/have an advantage in today's marketplace because it/they finds/find out what customers want and what they need.

An emphasis on sales strategies and techniques encourages consumers to purchase a good or service. Sales-driven companies frequently put less emphasis on long-term outcomes than they do on making quick sales. The emphasis is on increasing profit margins rather than figuring out what consumers want or meeting their needs.In order to present a sales pitch or inform customers about discounts and promotions, sales representatives in call centers frequently use outbound cold calling techniques. Customers today are less accepting of outbound sales techniques due to changing customer demands.Instead, consumer empowerment (across all industries) sparked a shift toward inbound sales/marketing strategies that place a focus on enhancing the customer experience and developing trust in order to increase sales and brand engagement.

To know more about sales oriented here

https://brainly.com/question/17314073

#SPJ4

when the price of a good increases and, as a result, producers sell more of it, we can say there is a correlation between price and the quantity supplied.

Answers

The price of an item and the amount supplied do, in fact, have a positive relationship, and we can thus claim that there is a correlation between the two.

How much more do producers supply when the price of a good rises?

For each unit of a good or service sold, the manufacturer is paid a price. The quantity of that good or service that is delivered will almost always increase as the price of that item or service rises, while the opposite is true when the price of that good or service falls.

What occurs if the cost rises?

The Law of Demand is what economists refer to as. The demand for a product decreases as the price rises (but demand itself stays the same). The quantity demanded rises if the price drops. This is the Rule of

To know more about Price of a good  visit:

https://brainly.com/question/5189510

#SPJ4

For each type of goal listed below, indicate the level of management responsible for setting that type of goal.

Answers

Operational goals  - lower  management

Strategic goals    -  top management

Mission statement - board of directors

Tactical goals - middle management

Explanation:

Operational objectives: Operational objectives are clearly stated for daily tasks and requirements to keep a business running. It is simple for representatives to function and flourish in their workplace thanks to effective actions.

Strategic objectives: The specific financial and non-financial objectives and outcomes that a business expects to achieve over a specific period of time, often the next three to five years, are known as strategic goals.

Mission statement: A mission statement provides a concise explanation of the association's purpose for existing. It illustrates the association's goals and broad expectations.

Tactic objectives: Focus is placed on setting quick-to-implement tactical goals in light of actual events as they arise. Whereas strategies rely on current real circumstances, systems depend on future forecasts.

To learn more about level of management visit;

https://brainly.com/question/1991930

#SPJ4

share 2 examples of companies that experienced a change in revenue as the result of a change in the price of the good or service they provided and explain which determinants of price elasticity of demand could be the cause of the change in demand

Answers

Two companies that experienced a change in revenue as the result of a change in the price of the good or service they provided  are Tesla and Netflix.

How did Change in Price affect the revenue of Tesla and Netflix?

Tesla: In early 2020, Tesla announced that it would raise the prices of its electric vehicles (EVs) by about 3% worldwide, citing the increasing cost of raw materials and foreign exchange rates as the reason for the price increase. However, the demand for Tesla's EVs did not decrease as a result of the price increase. In fact, Tesla's revenue increased by 37% in the second quarter of 2020 compared to the same period the previous year.

Netflix: In 2011, Netflix announced that it would be separating its streaming and DVD-by-mail services, and increasing the price for customers who wanted to continue receiving both services. As a result of the price increase, many customers cancelled their subscriptions, and Netflix's stock dropped by more than 60%. This can be attributed to the fact that the demand for Netflix's services is relatively elastic, as there are many substitutes available for streaming movies and TV shows online, such as Amazon Prime Video and Hulu.

Learn more about change in price here: https://brainly.com/question/27815322

#SPJ1

indicate whether each job listed below is more likely to be a managerial accountant or a financial accountant.

Answers

While financial accounting concentrates on a company's external financial procedures, managerial accounting is more concerned with the internal financial operations of the organization. Managerial accountants concentrate on quick-win expansion plans for sustaining the economy.

What is Financial Accounting and Managerial Accounting?Having both managerial and financial accounting experts is advantageous to organizations. Strong performers in these positions can give organizations the financial security and expansion possibilities they need. The responsibilities of each position should be understood by those thinking about a managerial or financial accounting profession.External parties (investors, industry regulators) use financial accounting documents like income statements and balance sheets. The financial statements show both the general financial health and the financial performance of a company over time. These statements are produced by financial accountants, whose work is regulated by organizations like the Securities and Exchange Commission (SEC).Financial papers used internally by corporations are produced by managerial accountants. In order to help executives maximize efficiency, the documents account for firm resources such raw materials, personnel, and equipment.Organizations can create complete plans to maintain and expand their business using both managerial accounting and financial accounting.

To Learn more About  financial accounting refer To:

https://brainly.com/question/26690519

#SPJ4

Accounting specialists may choose to explore careers in management or financial accounting,SEC Reporting Manager.

What is Financial Accounting and Managerial Accounting?Having both managerial and financial accounting experts is advantageous to organizations. Strong performers in these positions can give organizations the financial security and expansion possibilities they need. The responsibilities of each position should be understood by those thinking about a managerial or financial accounting profession.External parties (investors, industry regulators) use financial accounting documents like income statements and balance sheets. The financial statements show both the general financial health and the financial performance of a company over time. These statements are produced by financial accountants, whose work is regulated by organizations like the Securities and Exchange Commission (SEC).Financial papers used internally by corporations are produced by managerial accountants.

To Learn more About financial accounting refer To:

https://brainly.com/question/14546386

#SPJ4

listed here are product costs for production of soccer balls. classify each cost as either direct or indirect.

Answers

Each of the costs classified would be-Material cost: Direct; Equipment cost: Direct; Labor cost: Direct; Utility cost: Indirect; Rent cost: Indirect

Direct costs are charges associated with product and deals. The cost of raw material and labor  needed to manufacture a product would be  distributed as direct costs. The direct charges needed to manufacture a product or offer a service can be distributed as direct costs. The outflow charges that aren’t directly related to the product being manufactured but remain necessary to keep the business handling are  distributed as  circular costs. Circular costs are fixed charges a business incurs to keep the company running no matter the exertion  position. These costs,  frequently known as outflow, include executive, full- time staffing, property, factory, and  outfit (PP&E), and  mileage- related charges. Business charges can’t always be  distributed independently as either direct or  circular costs. Some charges,  similar as power, can fall under both  orders or switch  orders, depending on your company’s  product system.

Learn more about costs here:

https://brainly.com/question/30045916

#SPJ4

a company that has never previously issued securities registered with the securities and exchange commission, can register in a state by: i filing ii coordination iii qualification

Answers

A business that meets the requirements can register in a state even though it has never issued securities before and is not registered with the Securities and Exchange Commission.

The U.S. Securities and Exchange Commission (SEC), an independent federal government regulatory agency, is in responsibility of protecting investors, maintaining the fair and orderly operation of the securities markets, and encouraging capital formation.

After being formed by Congress in 1934, it acted as the first federal securities market regulator in the country. The SEC promotes full public transparency, protects investors from dishonest practices and market manipulation, and monitors corporate takeover activity in the nation. It also enables bookrunner registration statements between underwriting firms.

To know more about Securities and Exchange Commission click here,

https://brainly.com/question/9089676

#SPJ4

Other Questions
How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline all of the following statements regarding the gulf war of 1991 are true except that select one: a. the united states suffered relatively few casualties in the war. b. the allied ground offensive focused on dislodging iraqi forces dug-in along the kuwait border. c. almost all islamic and arab nations joined a trade embargo against iraq. d. the united nations voted in favor of american policies toward iraq. e. the allied forces ultimately numbered 690,000 troops. a network administrator notifies a technician that the company is experiencing a ddos attack. several internal windows pcs are the source of the traffic. the network administrator gives the technician the windows computer names and states they be scanned and cleaned immediately. with which of the following types of infections are the pcs most likely infected? (select two.) soapy's suds makes and sells root beer. its beginning work-in-process inventory was $12,000 and the ending work-in-process inventory was $10,000. during the year, soapy used $45,000 of direct materials and incurred $30,000 of direct labor in production. its cost of goods manufactured for the period was $97,000. how much manufacturing overhead did soapy incur during the period?