Answer:
Cancer is basically a disease of uncontrolled cell division. Its development and progression are usually linked to a series of changes in the activity of cell cycle regulators. For example, inhibitors of the cell cycle keep cells from dividing when conditions aren’t right, so too little activity of these inhibitors can promote cancer. Similarly, positive regulators of cell division can lead to cancer if they are too active. In most cases, these changes in activity are due to mutations in the genes that encode cell cycle regulator proteins.
Explanation:
The mutated (cancer) cells show the evidence that they do not respond to contact inhibition because there is no stopping of division of the cells.
Normal cells VS mutant cellsNormal cells show response to contact inhibition when they come into contact with other cells, so they stop moving and dividing.
While on the other hand, The mutated (cancer) cells show the evidence that they do not respond to contact inhibition because there is no stopping of division of the cells so we can conclude that no stopping of division occurs which is the evidence that the cancer cells show no response to contact inhibition.
Learn more about mutation here: https://brainly.com/question/17031191
1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me
Answer:
"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."
Explanation:
Hope this helps :)
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?
Answer:
A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals
Answer:
definitely D because a rainforest is extremely vast when it comes to different species
Explanation:
brainliest plz?
The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.
What is ecosystem?An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.
It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.
The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.
For more details regarding ecosystem, visit:
https://brainly.com/question/15011558
#SPJ6
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons
Answer: transfer of electrons
Explanation:
correct order of events during the process of nucleosynthesis?
Answer:
hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed
Explanation:
Answer:
A
Explanation:
took the quiz
As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.
Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)
Hope this helped and good luck!
-Nea
Answer:
C. Increased severity of tropical storms
Explanation:
Due to increased water temp and increased evaporation
How could one determine if two
unidentified organisms share a common
ancestor?
Answer:
Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.
Explanation:
DNA
They can look at the DNA it's the most common one.
There are 4 pieces of evolution and they are
Fossils , Geography , Embryos / DNA , Anatomy
Fossils: Physical remains of species , Determine age, location, environment
Deeper layers = older
Geography: Proves species share common ancestors, depending on where
they live
DNA: BEST evidence because it’s the MOST ACCURATE
Similarities in the early stages of development
Similarities in DNA
More similarities = closely related
More differences = not related
Anatomy: Compare body parts of different species to see how they evolved
3 different structures:
Homologous (same structure, different function)
Analogous (similar structure, different organisms)
Vestigial (body parts that no longer serve a purpose)
All of that are in evolution
Hope it helped! ( Gave u my biology notes :D)
When is carbon dioxide released during aerobic cellular respiration?
Answer:
I hope this helps and rate it if its right
Explanation:
I hope this helps and rate it if its right
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:
A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.
Answer:
A
Explanation:
the northern hemisphere is the opposite from the southern hemisphere
Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.
Why are the seasons reversed in each hemisphere?The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.
Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.
Learn more about seasons, here:
https://brainly.com/question/12028829
#SPJ2
which layer of the earth is made out of melted metal?
The outer core. A molten nickle- iron alloy.
A molecule of oxygen gas contains two:
O molecules
O elements
O atoms
Answer:
O atoms
Explanation:
:)))
A molecule of oxygen gas contains two atoms of oxygen bonded together.
Answer: your answer will be C
what is reduced soil?
Answer:
A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
how does the respiratory and digestive system work together to maintain homeostasis
The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.
HOPE IT HLPS UH WELL✌✌how do vital signs allow medical professionals to assess a patient's physiology and overall health
they measure the pulse rate and blood pressure of a patient, these can help to determine if a patient has any diseases of the blood or if they are under stress.
PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.
Thank You so Much
your amazing have a great life
What biotic factors might affect a population of fish? Check ALL that apply.
predators
prey
light
bacteria
Answer:
Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.
Explanation:
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle
Answer:
the nitrogen cycle, the water cycle, and the carbon cycle
Explanation:
The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.
The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.
What is a biogeochemical cycle?The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.
These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.
Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.
Learn more about biogeochemical cycles here:
https://brainly.com/question/1204069
#SPJ2
What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]
When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.
how do gray whales migrate?
Answer: Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.
Explanation:
How does the size of a bacterial cell compare with an animal cell?
Answer:
hope it helped
Explanation:
Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
What are 3 lines of evidence that corroborate the theory of evolution?
Answer:
Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.
Explanation:
I majored in Biology
Are gender traits completely a result of societal expectations?
Answer:
No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.