Name three sources of atmospheric carbon dioxide. (Write in complete sentences and be very detailed.)

This is science.
First and best answer gets 5 stars, a thanks, and a brainliest!

Answers

Answer 1
Simple and easy but three sources are:
1. Decomposition
2. Ocean Release
3. Respiration
Answer 2

Answer:

Yes, there are natural sources of atmospheric carbon dioxide, such as outgassing from the ocean, decomposing vegetation and other biomass, venting volcanoes, naturally occurring wildfires, and even belches from ruminant animals.[1]

[1](www.climate.gov/news-features/climate-qa/doesnt-carbon-dioxide-atmosphere-…)


Related Questions

Which plant cell structures capture sunlight to produce sugars? a. vacuoles b. ribosomes c. mitochondria d. chloroplasts​

Answers

Your answer is D. It uses light energy of the sun into sugars that can be used by cells. It is like a solar panel that changes sunlight energy into electrical energy.

The image below shows how wolves and dogs compare to some other animals in the levels of classification.



Based on this chart, which pair of organisms are most closely related?

Insect and rabbit
Cat and rabbit
Insect and fish
Cat and wolf

Answers

I think the answer is cat and rabbit

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

What are the like terms in the expression: 2a + 3b+ 40 - 5a + 8 - 4
O 2,3,4,-5
O 2a, 3b, 4c
O-5a, 8
O2a, -5a, 8, -4


i need help plzz

Answers

Answer: 2,3,4,-5

Explanation:

it seems that 40 is supposed to be 4c.

the terms can be grouped in several ways

2a, -5a                   Contain factor ‘a’

8, -4.                Simple integers/constants

2a, 4c,  8, -4.          Even numbers

2a, 3b, 4c,  -5a       Contain a factor      

Can’t group on + or - because values of a,b,c are unknown

From the available choices, only 2,3,4,-5 matches a logical group.

What larger part of the body do cells make up?​

Answers

Each cell has a size and shape that is suited to its job. Cells that do the same job combine together to form body tissue, such as muscle, skin, or bone tissue.

Answer:

i pretty sure it ovum :)

Explanation:

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
Not a long life story but a simple two reasons.

Answers

Answer:

1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.

2-They also don't reproduce independently but must replicate by invading living cells.

Viruses are considered non living since they are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy.

When does Algal Bloom occur?

Answers

Answer:

Explanation:

Algal bloom occur when there is too much of nutrients especially nitrogen and phosphorus which enhance more growth of algae and green plants in the water either fresh water or Marine water. When there is increase in algae growth, some die and cause discoloration of the water and pollution in the water.

Practice 5: Match the statement ends to the beginnings
A Shell
D. Cell wall
B. Provides protection and support for the cell
E. Controls what goes into and out of the cell
C. Cell membrane
1. All cells have a
2. Plant cells have a
3. The cell membrane
4. The cell wall
5. The cell wall's function is similar to, or like a

Answers

Answer:

A-4. the cell wall

D-5. the cell walls function is similar to, or like a

B-2. plant cell have a

E-3. the cell membrane

C-1. all cell have a

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells

What causes antibiotic resistance?
- Only using antibiotics when you are also doing radiation therapy
- Only using antibiotics when you are also doing chemotherapy
- Any use of antibiotics causes resistance
- We do not know

Answers

Answer:

Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria.

your welcome ;)

Explanation:

Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?

A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?

Answers

Answer: D. Can selection in nature also lead to a new species over time?

Explanation:

Answer:

Can selection in nature also lead to a new species over time?

Explanation:

Correct on edge 2021 hope this helps :)

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Which type of growth occurs when population growth slows or stops after a period of exponential growth?
decreasing
exponential
linear
logistic

Answers

Answer:

B

Explanation:

Answer:

B

Explanation:

True of False: Marsh was able to prove that animals changed over time.

Answers

Answer:

True

Explanation:

Hope this helps :D Have a great day..can i hav brainliest?

I think the answer is true


:):):):):):):):)

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Can someone help me to translate and transcribe this strand of DNA T A C A A T A T A G G G C G G C A G T T G T G G T A G T T T G T C C C T A T T

Answers

What type of translation is it?

In the light independent reaction _____, ______, and ______ combine to make ______ and ______

Answers

Answer/Explanation:

In the light independent reaction carbon dioxide, ATP, and NADPH combine to make glucose and oxygen.

Which of these are an important part of a scientific process? ​

Answers

Answer:

Is it multiple choice?? If it is, then show us the options

Explanation:

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

What are three differences between rocks and soil

Answers

Answer:

Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.

Which human activity negatively affects the stability of the environment?

Answers

Answer:

Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.

Explanation:

Brainliest?

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

I have a question.... my teacher today in biology said " you think you are moving your hand by yourself, but it's actually your brain sending commands to your muscles so they can move." So I wondered.. is my brain sending commands so I can think, or am I thinking whenever I have a desire to? (Not a trick question; My friend thinks this is a trick question lol).

Answers

Answer:

you are think of a command and your brain respond to you desire

Explanation:

Other Questions
After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. When Muhammad was a boy, he received religious teaching from whom?Group of answer choicesJewsPolytheistsProtestant ChristiansNestorian Christians condemned to be heretics Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Which two numbers have a mean of 10 and a range of 4?NEED THIS ASAP PLEASE I WILL LEAVE A GOOD RATING I need helppppp with this please Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets?