Mrs. Clearwater paid $38.64 to fill up 12 gallons of gasoline in her car. What is the price for 1 gallon of gasoline?

Answers

Answer 1

Answer: $3.22

Step-by-step explanation:

We will start by doing 38.64 divided by 12

Then we will get the answer 3.22.

$3.22 is the answer.

Answer 2
Well, to solve this answer, we will divide $38.64 by 12 gallons.
= $3.22/gallon.
Also, I just want to say happy new year to you and have a fantastic rest of your day!
Also, can you please mark my answer as the brainliest answer?
Thanks.

Related Questions

a porcupine has a mass of 27 kg. A.
cat has a mass of 6,300 g. Which
animal has the greater mass?

Answers

Answer:

porcupine

Step-by-step explanation:

6300g = 6.3 kg

Step-by-step explanation:

the porcupine has more mass

HELP HELP HELP!!!!! Please help!

Answers

Answer:

Regular peanut butter - .23

Family Size Peanut Butter - .15

Answer:

#1: 0.23

#2: 0.15

Step-by-step explanation:

1.38/ 6= 0.23

6*0.23= 1.38

7.80/ 52= 0.15

0.15*52= 7.80

please help . me . i will even help . you mark you brainliest

Answers

A = Not sure

B= 12.0

Hope I helped

Can someone explain how to work this out please ?

Answers

Answer:

x=4

Step-by-step explanation:

f(x) = (x-2)^5  +3

Let f(x) = 35

35 = (x-2)^5  +3

Subtract 3 from each side

35-3 = (x-2)^5  +3-3

32 = (x-2)^5

Take the fifth root of each side

32 ^ (1/5) =  (x-2)^5^ 1/5

2 = x-2

Add 2 to each side

2 +2 = x-2+2

4 =x


What is the absolute value of -9?

Answers

Answer:

9

Step-by-step explanation:

Absolute value means the distance from 0 on a number line, and -9 is 9 spots away from 0

Answer:

9

Step-by-step explanation:

Absolute value just means the positive value of the number


A ladder rests 22 feet up the side of a building. If the base of the ladder is 20 feet away from the building, how tall is the ladder to the nearest hundredth?

Answers

Answer:

Length of ladder =L =15

Distance from wall = D =9

Height on wall = H =??

Pythagoras equation L*L = D*D + H*H

15×15= (9×9) + H×H

225-81 = 144 =HxH

H= 12 feet.

I am right or wrong

please check

Tell which number is greater.

1/3, 30%

Answers

Answer:

They are equal.

Step-by-step explanation:

In my opinion 1/3 is grater because three 1/3's makes a whole. 30% three times is only 90% of the whole.

The volume of a cube 512 cubic inches. What is the length of the cube?

Answers

Answer:

I believe it is 8in

Step-by-step explanation:

someone correct me if I'm wrong

Which of the following represents a non-linear equation?
A. y = 3x + 3
B. y = -3x
C. y = 1/3x + 3
D. y = 3/x

TIMED PLEASE HELP!!!!

Answers

Answer:

D

Step-by-step explanation:

====MATH QUESTION====Extra points

Answers

I think the answer is A :) i hope this helps

You roll a dice twice.
Find the probability of getting 3 in first throw and 5 in second throw.

Answers

Answer:

1/6

Step-by-step explanation:

there are 6 faces on a dice so there's a 1 in 6 chance that you would roll a 3 on your second go there is still only a 1 out of 6 chance of getting a 5 because there is still 6 numbers you could roll on.

hope this helped

Please help im stuck

Answers

The scale factor is 1.6

solve the system by substitution y=x-8 y=2x-14

Answers

Answer:

Solve for the first variable in one of the equations, then substitute the result into the other equation.

Point Form:

(6,-2)

Equation Form:

x=6,y=-2

Step-by-step explanation:

The value of x is 6 and y is -2.

What is Substitution Method?

The algebraic approach to solving simultaneous linear equations is known as substitution method. The value of one variable from one equation is substituted in the second equation in this procedure, as the name implies.

When a variable (or set of letters) in an algebraic statement is substituted, its numerical value is used instead.

Given:

y=x-8..................(1)

y=2x-14.................(2)

Substitute the value of y from equation (1) to equation (2), we get

x-8 = 2x- 14

2x - x = -8 + 14

x = 6

and, y= x-8

y= 6-8

y= -2.

Hence, the value of x is 6 and y is -2.

Learn more about Substitution Method here:

https://brainly.com/question/14619835

#SPJ2

Select all the correct answers

Answers

Answer:

12^3,

Step-by-step explanation:

Need help plz!!!!!!!!!

Answers

Answer:

x = 35

Step-by-step explanation:

[tex]40 + 2x + 2x = 180[/tex]

Subtract 40 on both sides.

[tex]2x + 2x = 140[/tex]

[tex]4x = 140[/tex]

Divide with 4 on both sides.

[tex]x = 35[/tex]

Somebody help plz!!! I need some help I’m struggling

Answers

Answer:

4

Step-by-step explanation:

I will give brainliest to who answers this. Please answer quick

Answers

Answer:

Im pretty sure it would just be g= -p+15

Step-by-step explanation:

I really hope this helps, if not I am so sorry

Answer:

G= 1/6p -15

Step-by-step explanation:

Let's solve for g.

p=6g+90

Step 1: Flip the equation.

6g+90=p

Step 2: Add -90 to both sides.

6g+90+−90=p+−90

6g=p-90

Step 3: Divide both sides by 6.

6g/6 = p−90/6g

=1/6p−15

Find the lcm of 5m^7+ 35m^6+50m^5 And -20m^5-80m^4+100^3

Answers

Answer:

LCM of both polynomials=[tex]\mathbf{5m^3}[/tex]

Step-by-step explanation:

Least Common Multiple

We are given the polynomials

[tex]5m^7+ 35m^6+50m^5[/tex]

[tex]-20m^5-80m^4+100m^3[/tex]

Find the common factors of each polynomial, first the coefficients:

5 = 5

35 = 5*7

50 = 5*5*2

The common factor with the least exponent; 5

Now for the variables:

[tex]m^7, m^6, m^5[/tex]

The common factor with the least exponent; m^5

LCM of [tex]5m^7+ 35m^6+50m^5: 5m^5[/tex]

Similarly:

20 = 2*2*5

80=2*2*2*2*5

100 = 2*2*5*5

Common factor of the coefficients: 2*2*5=20

Common factor of variables: [tex]m^3[/tex]

LCM of [tex]-20m^5-80m^4+100m^3 = 20m^3[/tex]

LCM of both polynomials=[tex]\mathbf{5m^3}[/tex]

i need help and i need the work shown.

Answers

Answer:

step by step below

Step-by-step explanation:

p+7≤16

p +7 - 7≤ 16 - 7

p ≤ 9

7p>-28

7P/7 > - 28/7

p> -4

or

-4 < p ≤ 9

wich multiple of 7 is greater than 45 and less than 50​

Answers

Answer:

49

Step-by-step explanation:

7*7=49

9. The hypotenuse of a 45°-45°-90° triangle is 5 sqrt 6. Find the length of one leg of the right triangle.

Answers

Answer:

5 ✓ 3

Step-by-step explanation:

using Pythagoras Theory

(5 ✓ 6 )2 =, 2 x square side

square leg length= 150/ 2=, 75

length =5 ✓ 3

Help me help me help me help me help me help me help me

Answers

Answer:

C. and A.

Step-by-step explanation:

1/6 is a positive number so that is automatically greater than -0.33 and 0.3 is  It's like, the bigger the number next to the negative sign, the MORE NEGATIVE it is, making it SMALLER.

Reward for answering question correctly:

So am I gonna get brainliest?

Hi it's Mia! '^' Give the other person brainliest, They worked hard to get the answer you needed! Have a wonderful day! :)

Which of the following is NOT a solution to the system of inequalities?
1. (0, 4)
2. (1, 2)
3. (2, 1)
4. (1, 5)

Answers

Answer:

3. (2, 1)

Step-by-step explanation:

The solutions are the points located inside the shaded region. The only point not located in that region is the point (2, 1). Therefore, (2, 1) is not a solution to the system of inequalities.

16-2k=14. what is the value of k​

Answers

Answer:

k = 1

Step-by-step explanation:

16 - 2k = 14

- 16       - 16

    -2k = -2

     -2     -2

       k = 1

Subtract 16 on both sides. -2k = -2
Divide -2 on both sides. k = 1

Temperature freezes at 0°C. Which of the following temperatures is below freezing?

Answers

There are no options, but anything with a negative symbols like -1, -2, -3, -4, -5, -etc.

Expand.
Your answer should be a polynomial in standard form.
(9+ m)(-m +9)=

Answers

Answer: -1m²+81

Step-by-step explanation:

correct standard form means that the terms are ordered from biggest exponent to lowest exponent.The leading coefficient is the coefficient

of the first term in a polynomial in standard form.

FoR example, (9+ m) (-m+9) = *(m+9) (-m+9) *m(-m+9) +9 (-m+9)* -1.mm+9m +9(-m+9) * -1m² +9m +9(-m+9) *-1m²+9m- 9m +81

answer -1m²+81

A: x/8=3/4
B: 2/5=x/40

Answers

Answer:

A.)x=6

B.)x=16

did u mean to solve it or do something else if this is not the way u mean i can do another way if u like

I’ve tried and none my answers match the choices

Answers

Answer:-13/3

Step-by-step explanation:

By what percent did
the Howard family's
water bill decrease from
June to July? June $110.00, July $50.00

Answers

54.55 percent.
Set a ratio:
50/110 = x/100.
Solved this gives you 45.45, but that’s what’s left over. You need to subtract this from 100% to get 54.55 percent.

Help pleaseeeeeeeeee

Answers

Answer:

The value for X is 25

Step-by-step explanation:

I hope this helps you out!

Other Questions
Which of the following Indian commodities was essential to European diet, and a big lure of European action in the Indian Ocean basin A - Pepper B - Salt C- Paprika D - Corn Which graph shows the system of equations{2x+3y=5 4x5y=1 Solve the equation:8n8=72Select one:n=20n=2n=8n=17 anong mga salita ang maiugnay sa salitang plano 5c times 3c squared to the third power A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates.