masasabi mo bang maunlad ang kabihasnang binuo ng mga sinaunang tao bakit?​

Answers

Answer 1

Answer:

bat nasa Brainly Australia ka haha dapat nasa Brainly ph ka haha

oo dahil mas marami at matitibay ang mga binuo ng mga sinaunang tao at sila ay masisipag maghanap ng mga materyales na gagamitin.


Related Questions

Which of these phrases is a simile?
a My mouth reminds me a of dry desert.
b My mouth is a dry desert.
c My mouth contains a desert.
d My mouth is as dry as a desert.

Answers

It’s D a simile is just a sentence with Like or as

Answer:

D

Explanation:

A simile has the word "like" or "as" in it, a metaphor doesn't. Only D has "like" or "as".

What is indirect object word order? (Latin)

Answers

In Latin, the indirect object will frequently go between the subject and direct object, while in English the indirect object will go between the verb and the direct object.

Read this sentence.

Students who do not take the advice of their teachers are a lot more likely to fail than students who follow their teachers' advice.

Which of the following is the most concise way to write this sentence without losing important information?

Students who do not take the advice of their teachers are a lot more likely to fail than students who do not fail to do so.

Students who do not take the advice of their teachers are more likely to fail than other students who take the advice.

Students who take their teachers' advice are more likely to succeed.

Students should always follow advice from teachers.

Answers

Students who take their teachers’ advice are more likely to succeed

Answer:

Students who take their teachers' advice are more likely to succeed.

Explanation:

what does salve mean in Latin?

A.Hello
B.Friend
C.blood

Answers

Answer:

a

Explanation:

Answer:

A- Hello

Explanation:

Please mark brainliest

Which strategy can help you understand and enjoy classic literature?
a Rearrange words in your head so that they sound more like the way we talk today.
b Use a dictionary to look up every word you don't know.
c Read each paragraph several times before moving on to the next paragraph.
d Skip over the parts that you don't understand.

Answers

Answer:

Explanation:

A

Answer:

A

Explanation:

Rearrange words in your head so that they sound more like the way we talk today.

name this song Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself

Answers

YUUUUUPPP you have music taste
I don’t know this song buut looks good :)

Why does Rachel say, “only it's too late” after describing her birthday party?

Answers

Answer:

They would sing Happy Birthday when it wasn't actually a Happy Birthday.

Explanation:

I hope this helps xD 0_0

Natsukie-chan..
I see you making the guys shove the snow through my class window.. how dare you.

Answers

Answer: OOOOOOOOOOOO MAN STEALING I"M SEEING THIS . THIS CAT HAS A PLAN :)

Explanation:

Which statement most accurately characterizes the speaker in "I Dwell in Possibility"?


The speaker likes the opportunities offered by poetry.


The speaker is a gardener.


The speaker is a child longing for answers.


The speaker's knowledge of houses is important to her.

Answers

Answer:

The speaker likes the opportunities offered by poetry.

Explanation:

The speaker of the poem loves poetry, because it is a world full of opportunities. According to the speaker, poetry expands our mind, promotes reflection, stimulates the imagination and values our cognitive capacity, through its subjective and exploratory language. The prose cannot achieve this feat and is limited, as are the elements it stimulates in the human mind. There is no possibility in prose, but in poetry, yes.

Survival Story Snap Shot
Direction: Grab your "Mountain Chart Survival Story that you completed last class. Use the Mountain Chart to create a snapshot of your survival story. Be sure to
include all of the actions listed on your Mountain Chart Each box should show a part of your story Be creative
Establish
Initial Action
Rising Action
Climax
Fating Action
Resolution/Ending

Answers

Answnaiii

Explanation:

cling Starfish onto rocks
their with feet.
Fix the sentence

Answers

Answer: Starfish cling onto the rocks with their feet.

Explanation:

Easy

Other Questions
Abdul bought a loaf of bread for $1.59 and a package of cheese for $2.69. How much did Abdul spend? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. When Muhammad was a boy, he received religious teaching from whom?Group of answer choicesJewsPolytheistsProtestant ChristiansNestorian Christians condemned to be heretics Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image I need helppppp with this please Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below