Answer:
External would be skin, nose hair, etc. Internal is white blood cells and bacteria that the body makes to help prevent infections.
Explanation:
which describes a eukaryotic cell,but not a prokaryotic cell?
⦁ In what stage of an animal’s life cycle do most cells differentiate?
Answer:
Reproduction
Explanation:
Answer:
Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.
⚠️Second time posting this⚠️
the factors that control genes are called "alleles".
True
or
false
Answer
Explanation:
I think its true
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
A student states that petrification occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution. What is wrong with this statement?
A.
Permineralization occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution.
B.
Petrification occurs when once-living tissues are replaced by minerals, preserving the organism's structure.
C.
Both A and B describe errors in the statement.
D.
Nothing, this statement is correct as is.
Answer:
C. Both A and B describe errors in the statement.
Explanation:
In fossilization i.e formation of fossils, two terms are used as follows: permineralization and petrification.
- Permineralization is a process whereby the pore spaces of an organism's remains are filled with mineral matter that precipitates from lake and ocean solutions.
- On the contrary, petrifaction or petrification is the process whereby a once-living tissue (matter) are REPLACED by minerals, hence, preserving the organism's structure by turning it into a stone (petros).
According to this question, the student mixed up their definitions by giving the definition of permineralization instead, however, options A and B have described the errors associated with the statement.
please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?
Answer:
A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.
During which phase of mitosis do the chromosomes pull away from the middle of the cell?
In Anaphase of mitosis chromosomes pull away from the middle of the cell.
During this period the replicated chromosomes are split and moved to the opposite poles of the cells.What is mitosis?It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.
What are chromosomes?It is along DNA molecule with part or all of the genetic material of an organisms.
To know more about mitosis here
https://brainly.com/question/26678449
#SPJ2
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?
Answer:B
Explanation:
List some animals affected by soda cans and plastic bottles
Answer:
turtles, fishes, birds, whales, cats, dogs, really any animal can be affected
Explanation:
(any animal in the ocean) mark as brainliest plz
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?
Answer:
Due to splitting of lands.
Explanation:
These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
The table below shows the initial and final masses of a radioactive material whose half-life is 15 years.
Initial mass (in kilograms): 0.8
Final mass (in kilograms): 0.05
Based on the table, which of these conclusions is correct?
A.) The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.
B.) The material decayed from 0.8 kilograms to 0.05 kilogram in 30 years.
C.)The mass of the material was 0.1 kilograms after four half lives.
D.) The mass of the material was 0.1 kilograms after five half lives.
Answer:
A
Explanation:
1 half-life = .4 kg = 15 years
2 half-life = .2 kg = 30 years
3 half-life = .1 kg = 45 years
4 half-life = .05 kg = 60 years
Answer:
A
Explanation:
Initial mass is 8. The half-life is 15 years.
1st half life=.8/2=.4
2nd half life=.4/2=.2
3rd half life=.2/2=.1
4th half life=.1/2=.05
For each half life that it took it to go from .8 to 0.05, you add 15 years since that is the half life of the substance. 4*15=60.
So, the answer is A. The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.
What is the energy source that allows photosynthesis to occur?
Answer:
[tex]\boxed {\boxed {\sf The \ sun }}[/tex]
Explanation:
Photosynthesis is a special process that certain organisms (plants, algae, and some bacteria) undergo to create "food".
This turns light energy, carbon dioxide, and water into glucose and oxygen. The glucose becomes the food for the organism, because it is turned into ATP during cellular respiration. The ATP is energy that fuels the processes, like growth, repair, and transport.
This process occurs because of the sun. It provides the light energy needed for the reaction. Organelles inside of the cells, called chloroplasts, contain a pigment (chlorophyll) that captures this energy.
4) After a horrible car wreck, Jamie had a broken ankle, a few minor cuts, scratches, and a
large bruise across her chest from the seatbelt. While at the hospital, they kept checking her left
lung because it kept collapsing.
What systems are affected?
Why?
what is the atmosphere for gas essential for animal life?
Answer: oxygen
Explanation:
Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False
Answer:
true
Explanation:
Answer:
False.
Explanation:
Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.
Have a great day! (:
at which temperature would air hold the least water vapor?
Answer: I believe it's 60 degrees Fahrenheit or less, Since heat is required to have proper evaporation, then this will only be leading to a portion of the water condensed leading to a half condensation
Explanation:
Answer:
the coldest temp in F holds the least amount of water vapor..
In what ways is the composition of the sun different from the Earth? Choose all that apply.
The Sun does not have continents.
O The Sun has a thick, solid core.
O The Sun does not have a solid surface
The Sun does not have a solid core.
The Sun has continents known as plasma zones.
Answer:
1,3,4
that's my answerrrr
What are the locations and end products for the processes of transcription and
translation?
The cytoplasm is the site of translation, the next process that converts a gene into a protein. In order to “read” the sequence of mRNA nucleotides, the ribosome, a specialized complex, interacts with the messenger RNA.
What is role of gene expression in an organism?It serves as both a volume control that raises or lowers the level of proteins produced, and an on/off switch to regulate when proteins are created.
Because a particular protein can only be made when its gene is turned on, gene expression is significant.
But the process of turning a gene into a protein involves numerous steps, and one of these phases—the production of proteins—is essential for the gene expression pathway that can be altered in cancer.
Therefore, transcription occur at nucleus and translation take place in cytoplasm.
Learn more about gene expression here:
https://brainly.com/question/14182257
#SPJ6
What are the advantages and disadvantages of a honey bees sexual reproduction
Answer:I just learned this.
Explanation: The Advantage is that they have plant pollination and honey.
what would be the most beneficial towards maintaining equilibrium in an ecosystem over a long period of time?
a)organisms imported by humans from other environments
b)a sudden change in climate
c) a diversity of organisms
d)predators eliminated from the food chains
Answer:
c) a diversity of organisms
Explanation:
Biodiversity refers to the number of different species of animals,plants and microorganisms.Biodiversity increases ecological stability in changing environments.Biodiversity reduces competition ,provide more food resources,increases ecosystem productivity etc.
A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.
Answer:
Photon, light dependent reaction of photosynthesis
Explanation:
Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.
There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.
In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.
Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".
Which is required for sexual reproduction
Answer:
meiosis
Explanation:
meiosis is used to produce gametes for sexual reproduction
Answer:
Meiosis, and female and male
Explanation:
Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.
how does water pollution harm water ecosystems?
Answer:
the animals die due to the chemicals and stuff in the water
Explanation:
According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.
Answer:
the hard work he went through