January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

Answer 1
This is because the frequency of of a wave is a number of repeating event per unit time.

Related Questions

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone​

Answers

Answer:

1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes

Explanation:

The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Wyatt has heart problems

Answers

???? what is you talking about

Answer:

If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.

How does biology affect behavior?

Answers

Answer:

some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.

Explanation:

There you go

Biology is a normal thing it diesnt really effect us

PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS

Answers

Answer:The answer is the person and the tennis ball :)

Explanation:

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB

Answers

Answer:

Image result for what is The recessive gene for blood typing

Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.

Explanation:

Brainliest if right?

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

trna is bring a ggu anticodon what amino acid do you infer it will be carrying?

Answers

Proline

This is the amino acid that corresponds to GGU

Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass

Answers

Answer:

D. The glass.

Explanation:

Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.

Hope this helps :D

The correct answer is D. The Glass Explanation: since the atoms in solids are closer together they would transfer sound the best, because sound travels best through solids

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

structures in the cell

Answers

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT

Answers

Answer: A U G U G G A A C C G C U G C U G A

Explanation:

Answer:

AUGUGGAACCGCUGCUGA

Explanation:

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

People in the Middle Ages were beginning to question:

Drama
Authority
Scientists

Answers

I think it is Authority hope this helps

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

Other Questions
I really need help for this geometry question, I would appreciate any help thank you. do u have a dream job 7x-6y=95x+2y=19 Solve the system using elimination. Hale: Excellency, it is a natural lie to tell; I beg you, stop now beforeanother is condemned! I may shut my conscience to it no more-privatevengeance is working through this testimony! From the beginning this man hasstruck me true. By my oath to Heaven, I believe him now, and I pray you call backhis wife before we-" 16. What do we learn about Hale's character through thispassage? *He is capable of making a decision based on logical and valid evidence, even if it goesagainst his original suspicions.He is intimidated by Danforth's power as a judge and wants to remain a part of theproceedingsHe cannot stand to see people suffer, no matter their guilt or innocence.He feels the only way he can get into heaven is to save more people instead ofcondemning them. What is the surface area? What is the LCM of 2 and 8 PLS RESPOND FAST!! What is the value of x in the diagram belo2vA. 9B. 8C. 7D. 6 What groups of people might you come across whilst working within the public services? find the measure of m ITEM BANK: Move to BottomBalanceMeasured in NewtonsMeasured in gramsProperty of matterSpring ScaleWeightBothMassCugan 100drag and drohte How can you help reduce violence from school? please help me please help me. Why should you avoid contractions and slang in a formal essay?A.Contractions and slang are usually reserved for Informal syntax.B.Teachers do not like slang and contractions.C.Contractions and slang are hard to read.D.You can use slang or contractions if they are in the dictionary. Which countries sent the most immigrants to America between 1860 and 1900? "When he slammed his book-bag on the ground, the boy's iPad screen broke." Is this a simple or compound sentence? ill give brainliest to whoever answers difference between republicans and democrats means the Way, or the Path.OA) DaoOB) ConfuciusOC) Lao-tzu 38=p15 PLEASE HELP MEHHHHH Toy Universe is manufacturing a new toy and deciding on a price that will result in a maximum profit. The graph below represents profit (P) generated y each price of a toy (x). **Graph is attached below (sorry the picture is bad quality)**Part A: If the company wants to make a maximum profit, what should the price of a new toy be?Part B: What is the minimum price of a toy that will produce profit for the company? Explain your answer.Part C: Estimate the value of P(10) and explain what the value means in the problem and how this may be possible.Part D: If the company wants to make a profit of $137, for how much should the toy be sold.Part E:Find the domain that will only result in a profit for the company and find its corresponding range of profit.Part F: The company owner believes that selling the toy at a higher price will result in a greater profit . Explain to the owner how selling the toy at a higher price will affect the profit.