In the walls of the heart, two layers of tissue form a sandwich around a thick layer of muscle called the ______________________.

Answers

Answer 1

Answer:

myocardium

Explanation:

makes up the middle and thickest layer of the heart wall.


Related Questions

What is the diploid phase?​

Answers

Answer:

In the sporophyte phase a diploid (having two sets of chromosomes) plant body grows and eventually produces spores through meiosis. These spores divide mitotically to produce haploid (having a single set of chromosomes) gamete-producing bodies called gametophytes.

Explanation:

Hope I Help?

Please Mark Me Brainly!!

Question 14
The energy that drives the water cycle originates from:

a
The sun
b
The global wind system
c
Surface and ground water
d
Thermohaline circulationL

Answers

Answer:

the sun

Explanation:

the sun is energy that controls all weather activity. (pretty much)

Hydroponics are agricultural systems focusing on which of the following methods?


softscape design

soil-free planting in water

oceanside shore plantings

xeriscape planting without water

Answers

c.) oceanside shore plantings

HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP

What would most likely happen if coastal North Carolina increased implementation of wind energy?

A. Investment costs to taxpayers would decrease.
B. The population of greenhouse gases would decrease.
C. Turbines could be built in highly populated areas because of low noise pollution.
D. The energy output would be consistent because wind patterns are always predictable.

Answers

Answer:

The answer would be A because it would decrease

Answer:

A. Investment costs to taxpayers would decrease.

define ammonotelism?​

Answers

Answer:

It is the excretion of ammonia and ammonium ions

Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.
Match the words with their definitions.
runoff
precipitation
transpiration
condensation
groundwater
evaporation
process in which plants release water vapor into the air
process in which water changes to a vapor
water that falls from clouds toward the ground
water vapor that cools down to form water droplets
flowing of rainwater downhill to form streams and rivers

Answers

Transpiration: process in which plants release water vapor into the air
Evaporation: process in which water changes to a vapor
Precipitation: water that falls from clouds toward the ground
Condensation: water vapor that cools down to form water droplets
Groundwater: flowing of rainwater downhill to form streams and rivers

Transpiration: process in which plants release water vapor into the air.

Evaporation:   process in which water changes to a vapor.

Precipitation:   water that falls from clouds toward the ground.

Condensation: water vapor that cools down to form water droplets.

Runoff:  flowing of rainwater downhill to form streams and rivers.

What is water cycle?The water cycle shows the continuous movement of water within the Earth and atmosphere. It is a complex system that includes many different processes. Liquid water evaporates into water vapor, condenses to form clouds, and precipitates back to earth in the form of rain and snow.Water cycle involve  the  evaporation, transpiration, condensation, precipitation and runoff.

To know more about water cycle here

https://brainly.com/question/1151425

#SPJ2

A food web shows how energy moves from one organism to another in an ecosystem. Students in a life science class created a diagram demonstrating a food web.
FOOD WEB
Owl
Snake
Hank
Frog
Grasshopper
Mouse
Rabbit
Caterpillar
Wheat
Dandelion
Clover
Based on the food web, which of these organisms receives its energy directly from a primary consumer?
caterpillar
dandelion
frog
grasshopper

Answers

Frog, it eats a grasshopper which eats plants
frog;
the are a secondary consumer, so they eat the primary consumer such as a grasshopper which eats the producer.
so a FROG receives its energy directly from a primary consumer

True or false: A cell's DNA is replicated during the M phase of the cell cycle.​

Answers

The answer is False

help me guys please





without 1​

Answers

Answer:

1. D AND B

2.B

3.D

.................. THAT ALL I KNOW

need answer quick please thanks

Answers

It’s c I looked it up

Students carry out an experiment to test how white button mushrooms grow best. They begin with identical trays that contain straw, wood chips, and compost, as well as the hyphae that will form the mushroom caps. The students' are experiment and results are described in the table.
Which statement Best describes the students' results?

A) Mushrooms grow better at the cooler temperature.
B) Mushrooms grow better at the warmer temperature.
C) Mushrooms grow better when exposed to light for longer periods.
D) Mushrooms grow better when exposed to light for shorter periods.

Answers

I think it’s B hope that helped

The statement that Best describes the students' results is option A. Mushrooms grow better at the cooler temperature.

Result of the student:

Since the students' are experiment and results are described in the table.

So based on this, we can say that the mushroom should grow better at the cooler temperature.

Also, the number of mushroom should be 34.

Therefore, the option a is correct.

Learn more about experiment here: https://brainly.com/question/2700122

Which of the following has been proven true by researchers of identical twins?

a. Identical twins have different personality genes.
b. Identical twins are never the same gender.
c. Identical twins share the same DNA and blood type.
d. Identical twins are no more alike than fraternal twins.

Answers

Answer: B. Blood Type

Explanation: Got it right on edge

The cactus has a specialized fleshy stem that is specialized to store water for long periods of time. Which plant tissue most likely makes this action possible?

I know the answer is Ground, but i need to know WHY the answer is ground tissue. I WILL MARK BRAINLIEST

(on EDGE)

Answers

Answer:

If I were to guess its probably Vascular

Explanation:

Cactuses can store water nearly four months mainly in the winter and watering is not required for them frequently during that time. The stem acts as a reservoir for the amount of water it holds. The ground tissue of cactus has lots of parenchymal cells that store water.

What is parenchyma?

The ground tissue system comes from a ground meristem which has three tissues, namely parenchyma, collenchyma, and sclerenchyma.

The ground tissue of cactus has many parenchyma cells that store water.

Thus, it can be concluded that the ground tissues helps cactus to store water for a long time.

For more details regarding ground tissue, visit:

https://brainly.com/question/346979

#SPJ2

What factors may have contributed to the decreased size of the giant panda’s range?

Answers

Answer: low reproduction rates, hunting and most importantly habitat destruction

Explanation:

Which of the following cannot reliably prevent the impact of hurricanes on hurricane-prone places?

A)

restoring freshwater marshes

B)

allowing the growth of a natural buffer of trees

C)

completely preventing settlements in areas that seem prone to catastrophes

D)

encouraging people to avoid settling in areas known to be hazardous

E)

using satellite images to predict hurricanes

Answers

Answer:

I think the answer is d I hope this help

Answer:

A) restoring freshwater marshes

Explanation:

got it right on edg

The period during which a heart chamber is contracting is called . 2. The period during which a heart chamber is relaxing is called . 3. During ventricular contraction, the AV valves (tricuspid and mitral valves) are . 4. During ventricular relaxation, the AV valves are . 5. The pulmonary and aortic valves open when the pressure in the exceeds the pressure in the pulmonary trunk and aorta. 6. The first sound of a cardiac cycle occurs when the are closing. 7. The second sound of a cardiac cycle occurs when

Answers

Answer:

1.The period during which a heart chamber is contracting is called systole.

2. The period during which a heart chamber is relaxing is called diastole.

3. During ventricular contraction, the AV valves (tricuspid and mitral valves) are closed.

4. During ventricular relaxation, the AV valves are open.

5. The pulmonary and aortic valves open when the pressure in the ventricles exceeds the pressure in the pulmonary trunk and aorta.

6. The first sound of a cardiac cycle occurs when the atrioventricular valves are closing.

7. The second sound of a cardiac cycle occurs when the semilunar valves are closing.

Explanation:

We can divide the heart cycle into two parts the systole and the diastole. The systole happens when the heart walls contract, and the diastole when these relax.

The relaxation and contraction allow the flow of blood into the different heart chambers.

During diastole, blood flows to the right atrium from the vena cavae superior and inferior, and the coronary veins and to the left atrium from the pulmonary veins. The blood accumulated in the atriums causes the AV valves to open, and blood flows to the ventricles. In this part, the atrium pressure exceeds the ventricular pressure allowing the blood's flow. When the atriums contract, the remaining blood that was in them, goes to the ventricles. Throughout all this process, the pulmonary and aortic valve is closed due to a pressure difference.

During ventricular systole, there are two phases. First, the ventricles contracts themselves, and the ventricular pressure increases, being higher than the atrium pressure. As a consequence, the AV valves close. During this first phase of contraction, there is not enough pressure to open the pulmonary and aortic valves. In the second phase, the ventricles completely contract themselves, the ventricular blood pressure increases. It becomes higher than the pressure in the aortic and pulmonary valves. As a consequence, the blood pushes the valves open, and blood goes out of the heart. Then, the difference in pressure between the ventricles and the pulmonary trunk and aorta causes the valves in these areas to close.

The first sound that we listen to is the S1 and is during the ventricular contraction that closes the atrioventricular valves. The second sound is the S2, and it happens when the semilunar valves close, also knowns as aortic and pulmonary valves. S2 occurs during diastole once that the blood is out of the ventricle and the contraction has finished.

Which of the following is true of all protists?
O
A. They are all unicellular.
O
B. They are all capable of photosynthesis.
C. They are all eukaryotes.
0 D. They are all primitive plants or animals.

Answers

Answer:

Kingdom Protista was first described by Antony van Leeuwenhoek in 1675. The kingdom includes the majority of unicellular and eukaryotic organisms.

Explanation:

Protists are eukaryotic organisms such that they consist of a well-defined nucleus, membrane-bound cell organelles, and are mostly unicellular. However, some of the protists such as algae perform photosynthesis, some protists exhibit mutualism, and some are parasitic.  

Most of the protists are single cells, but they can exist in multicellular forms, in colonies, and can live as single-cell. Some of the examples include giant kelps, euglena, and diatoms.  

Protists such as alga are capable of performing photosynthesis. Photosynthesis is the process of preparing food in the presence of sunlight, water, and carbon dioxide to yield oxygen and provide energy.  

Protists are one of the diverse kingdoms in the classification of organisms as it comprises moulds, algae, and protozoa. Protists are not classified as plants, fungi, or animals. For example, the division Bryophyte is considered as a primitive division to plants, whereas kingdom Moneran is considered as most primitive.  

Can somebody please help me with all the question?

Answers

Answer:

no

Explanation:

Q9.
Figure 9 shows two sperm cells.
sperm A
sperm B
-Z
Figure 9
(i) Name structure Z.​

Answers

Answer:

what is with yall wemen and sperm

Explanation:

im a male

How many chromosomes does a human body cell contain?

Answers

Answer:

A human body contains 46 chromosomes in pairs of 2

Explanation:

A human body contains 46 chromosomes in pairs of 2

Explanation:

Which is not a function of the respiratory system? A. It warms air entering the body. B. It exchanges oxygen and carbon dioxide. C. It pumps blood to the organs.

Answers

Answer:

A. It warms air entering the body.

Explanation:

The respiratory system functions the organs and breathing.  B tells you that it exchanges oxygen and carbon dioxide, which is functioning breathing.  C is pumping blood into the organs, which is part of the respiratory system.

Hope this helped! :3

All the the cells are the same on the inside?
true or false?

Answers

Answer:

false

Explanation:

because the cells are unique and different

Answer:

Even though there are many different types of cells, they all share similar characteristics. All cells have a cell membrane, organelles organelles, cytoplasm, and DNA. ( is false)

What's does the term origin time mean in earth science

Answers

Answer:

Well depending on context it can mean different things, I could mean one of these three thing, choose the one you think is the most suitable,

(1) The birth, existence, or beginning; starting point. (2) The cause; that which causes something to arise. (3) That which acts as the source or that which from where something is derived.

If stripped fish become more visible to predators, their fitness for their environment will decrease. Over time ____ will favor solid-colored fish and their numbers will grow.

Answers

Answer:

predators

Explanation:

What factors do you need to know in order to calculate a region's population growth

Answers

The amount of people having baby’s or the amount of people dying

PLEASE I NEED HELP!!
Students are asked to make a model that shows each level of structural organization and its function in human beings. Which model should the students use to explain the hierarchy of levels of organization in human beings correctly?

Answers

Answer:

The correct answer is option A. muscle cell, muscle tissue, biceps, muscle system, and human being.

Explanation:

In humans and other mammals, there is a specific type of structural organization found in which involves fundamental units to the most exclusive level of organization. The cell is the most basic and fundamental unit of the organism's structure.

Cells joined together to form tissues like muscle cells form muscle tissues, tissues grouped with each other into organs like muscle tissue form biceps, different organs are grouped into organ systems like muscle system form from organs, and many organ systems come together to form complex organisms like human beings.

Qual das alternativas abaixo nao corresponde a função da agua? Solvente. Mudança de temperatura. Não tranporta substâncias. Hidrólise

Answers

Paul I do not know your Spanish friends looking for attention everyone doesn't work so I'm not

What kind of front does not cause a temperature change and producing light wind and precipitation?
A-Cold front
B-Occluded fronts
C-Stationary fronts
D-Warm front

Answers

Answer:

D. Warm front

Explanation:

Warm fronts typically have warmer and more moist air than the air in front of it. Replacing the cold air with warm air can cause precipitation.

natural selection compared to evolution

Answers

Evolution is not the same as adaptation or natural selection. Natural selection is a mechanism, or cause, of evolution. Adaptations are physical or behavioral traits that make an organism better suited to its environment. Heritable variation comes from random mutations.

Sound travels through substances as energy is transferred from one particle to the next. The
diagrams represent the particles of three substances: air (gas), water (liquid), and steel (solid).
Which substance would sound travel through the fastest?

Answers

Answer:

The correct answer is A...........

Other Questions
HAPPY APRIL FOOL'S DAY YA'LL MAY YOUR DAY BE FULL OF PRANKSremember in life is eat or be eaten, yeet or be yeet always remember that XDD 4. Suki will soon turn 18 and wants to move into her own apartment in a few years. But she isworried that she won't be able to rent an apartment without any credit history. What can Suki doto start building a good credit hitary?a. Rent an apartment with a friend who already has signed a lease.b. Continue to use her debit card responsibly, being careful to not overdraw on the accountC. Close her checking account to avoid bouncing a check.d. Get and use a store credit card or major credit card and pay off amounts due each month. Please help if you dont mind! 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. Is this a phraseor a clause?Because of the snowfall Find the greatest common factor of 14 and 28 What was one benefit and one drawback of faster textile production using machines?Fast please 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 3/4x 2 1/3 what is the answer to this question EnglishFlowers for Algernon question How is an IQ defined by the various characters (April 21)? which part in a mosque might be blocked 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! of sales tax is 6%, what is the final price of a Microwave oven whose list price is $110.00? What is the probability that Mary will get an "11"? Hlp meeee (convert the improper fraction to a mixed number Please help TIA!!!!!!!!