In the photo of the house; What is happening to the foundation of
the house?

In The Photo Of The House; What Is Happening To The Foundation Ofthe House?

Answers

Answer 1

Answer:

errosion is causing it to crumble and become unstable


Related Questions

PLEASE HURRY!!!

What determines the similarities in anatomical features among organisms?

Answers

Answer: genes and chromosomes

Explanation:

Which statement is true of reproduction that
involves two parents?
O A. Offspring are exact copies of the parent.
O B. Each parent provides the offspring with
genetic material.
O C. Single cells reproduce in this way.
O D. Bacteria reproduce in this way.

Answers

The answer is B, because each parent provides offsprings with genetic material with background coming from both parents which is how DNA forms and copy molecules.

I need help with this

Answers

Answer:

what is the name of this website

or the book?

Question 1. What change led to an increase in the number of light-colored moths within the population?
1. More mutations
2. Decreased pollution
3. More dark colored trees
4. Fewer humans

Question 2. Claim: Individuals in a population have genetic variations that can be passed on to their offspring. Refer back to the rabbits in the desert from the natural selection activity we did in class. How could an organism's traits influence the survival rate of the population?

Answers

Answer: 1. 1. More mutations. 2. According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

Can throat cancer be inherited?

Answers

Most throat cancers are generally related to smoking and not hereditary, unless the family members are predisposed to smoking.

No not really. Only genes

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Hitchhiker’s thumb (H) is dominant to no hitchhiker’s thumb (h). A woman
who does not have hitchhiker’s thumb marries a man who is heterozygous for
hitchhiker’s thumb. What is the probable genotypic ratio of their
children?
Group of answer choices

50% Hh : 50% hh

100% HH : 0% hh

75% Hh : 25% hh

0% Hh : 100% hh

Answers

Answer:

there is a 50 50 chance

Explanation:

have a nice day!;)

The probable genotypic ratio of their children is 50% Hh : 50% hh because the man is heterozygous for the hitchhiker’s thumb, hence option A is correct.

What is a heterozygous condition?

In some crosses, there are two conditions, in which some alleles are heterozygous and some are homozygous. In the homozygous trait, both alleles are the same, it may be dominant or recessive HH and hh, respectively.

The cross is between a woman who does not have a hitchhiker’s thumb and a man who is heterozygous for a hitchhiker’s thumb.

 

Cross: Hh X hh

Gametes: H and h

Genotype: Hh, Hh, hh, hh  

Phenotype: 50% of hitchhiker’s thumb and  50% not having hitchhiker’s thumb.

The cross is attached in the image below.

Therefore, due to the heterozygous condition of man genotypic ratio of their children is 50% Hh: 50% hh.

Learn more about heterozygous, here:

https://brainly.com/question/14584278

#SPJ2

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

Geranium leaves grow in positions that permit the optimum use of light as a result of

Answers

Answer:

do you work stop cheat broo this evan btw

Explanation:

Geranium leaves are typically arranged in a way that allows for optimal use of light through a process called "heliotropism" or "solar tracking."

What is heliotropism?

Heliotropism is the ability of plants to orient themselves towards the direction of the sun to optimize their exposure to light.

Geranium leaves are arranged in a rosette pattern, with each leaf emerging from the base of the stem and spreading outwards. The leaves are arranged in a way that maximizes their surface area while minimizing shading of other leaves. This arrangement allows the leaves to capture the maximum amount of sunlight possible.

Additionally, geranium leaves have a waxy cuticle that helps to prevent excessive water loss and damage from UV radiation. The leaves also have chloroplasts, which contain chlorophyll and are responsible for photosynthesis, the process by which plants use sunlight to produce energy.

Learn more about heliotropism, here:

https://brainly.com/question/1305135

#SPJ6

The body fluid of sharks has a much lower concentration of sodium chloride than that of the surrounding seawater, and yet they are able to remain in osmotic equilibrium with the external environment. How can this be the case? A. Sharks store enough urea in their bloodstream to match the total solute concentration of the surrounding seawater. B. Sharks are osmoregulators. C. Sharks maintain high levels of sodium chloride in their skin. D. Sharks drink large volumes of seawater to compensate for the low salt concentration of their body fluids. E. None of the answer options is correct.

Answers

a. Sharks store enough urea to match the total solute concentration of the surrounding seawater

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

ANSWER ASAP:
What are the basic
needs of humans? What are basic needs of
animals? How are these similar or different?

Answers

Answer: 1. Human beings have certain basic needs. We must have food, water, air, and shelter to survive. If any one of these basic needs is not met, then humans cannot survive.  2. In order to survive, animals need air, water, food, and shelter (protection from predators and the environment); plants need air, water, nutrients, and light. Every organism has its own way of making sure its basic needs are met. 3.Humans and Animals both have similar social skills. ...

We have facial expression similar to that of a mouse. ...

We talk things while sleeping just like dolphins. ...

Just like Humans, Cows also have regional accents. ...

Dolphins, just like Humans get occasionally high.

Explanation:

Pls help and thank me

Answers

I think the answer is b

Which best describes a recessive allele?

Answers

Answer:

B (imo)

Explanation:

Answer:

The answer for the question is D

What changes occur in taste receptors when the membrane is depolarized during receptor potential A. Voltage-gated Ca2 channels open, triggering the release of neurotransmitter. B. Voltage-gated Cl- channels open, triggering the release of neurotransmitter. C. Voltage-gated Ca2 channels open, inhibiting the release of neurotransmitter. D. Voltage-gated Cl- channels open, inhibiting the release of neurotransmitter.

Answers

Answer:

A. Voltage-gated Ca² channels open, triggering the release of neurotransmitters.

Explanation:

For taste mechanisms to function properly, it is necessary the activation of taste receptors.  

Through the activation of taste receptors, transduction cascades occur, involving ion channels that are located in the apical or lateral membranes. There occurs a subsequent release of chemical neurotransmitters that send signals to the control centers.

Salty and sweet flavors produce the membrane depolarization that results in Ca+ ions´ entrance to the cell. Ca+ initiates the release of neurotransmitters. Afferent gustative neurons receive the message and send it to the control center, the encephalon. After that, gustative cells go back to the initial state, repolarizing.

The regulation of body temperature is a contributor to homeostasis. What body
system is responsible for this?
Digestive System
Musculoskeletal System
Nervous System
Circulatory System

Answers

Answer:

its the nervous system and the endocrine system

Explanation:

the nervous and the endocrine are the bodys main regulators

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

6. Your friend is trying to gain some more muscle and has started lifting weights.
You read that muscle structure is primarily built by putting amino acids together through protein synthesis.
What foods should you recommend to your friend, so that they can increase the amount of amino acids in their diet?
1. Identify a food from the selection that they should eat.
2. Explain how you know that food has the macromolecule they need.

Answers

Answer:

He should start out doing little amount , any workout his wants but try to hold the weight for 1 min , making sure that he doesn't lift too fast instead he should do them slow and hold it for a while for he can feel the burn in his muscle and with time add the reps and hold it longer

Explanation:

1) Read the following paragraph and answer the following questions.
The countries which do not have oil reservoirs in their land, import oil from other countries. But sometimes during transportation of oil through sea routes, accidental oil spill occurs. This oil spilled in the ocean may prove fatal and toxic to aquatic animals. Therefore, removal of this spilled oil is essential for protection of aquatic life. For removing this oil layer, certain microbes like Pseudomonas spp and Alcanivorax borkumensis are used. These microbes have the ability to destroy the pyridines and other toxic chemicals. The hydrocarbonoclastic bacteria (HCB) are able to decompose the hydrocarbons and bring about the reaction of carbons with oxygen resulting in formation of CO​2​ and water. Like oil spills cause damage

to aquatic life, plastic forms the major part of the garbage on the land. Plastics are difficult to degrade as they are made up of PET, by research various species like Vibrio and Ideonella sakaiensis which can degrade PET have been identified. There are certain species of microbes which can decompose rubber from garbage.
a) How are aquatic organisms affected by oil spills in the ocean?
b) Which type of chemical compounds are degraded by microbes used for
clearing oil spills?
c) Name any two species of microbes which can degrade rubber from
garbage.
d) Why should there be a ban on plastic bags?

Answers

Answer: See explanation

Explanation:

a) How are aquatic organisms affected by oil spills in the ocean?

Aquatic organisms are affected by oil spilled as it is fatal and toxic to them. It can cause death, habitat degradation, vulnerability to predators and can also lead to the inability to hatch their eggs.

b) Which type of chemical compounds are degraded by microbes used for

clearing oil spills?

The chemical compound degraded by microbes are clearing oil spills are Pseudomonas spp and Alcanivorax borkumensis.

c) Name any two species of microbes which can degrade rubber from

garbage.

These are Vibrio and Ideonella sakaiensis.

d) Why should there be a ban on plastic bags?

There should be a ban on plastic bags as they're difficult to degrade as they are made up of PET.

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

what is the correct answer?

Answers

Answer:

Purple. Phenotype=visual characteristics

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

how do the two sets of muscles work together to make air enter the lungs

Answers

Answer:

Here you go

Explanation:

downward toward the abdomen, and the rib muscles pull the ribs upward and outward. This makes the chest cavity bigger and pulls air through the nose or mouth into the lungs.

What is the range for the following set of measurements?
3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL

Answers

The range of the set is 6.8,
because 8.7-1.9=6.8

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

Where doed fertilisation take place?

Answers

Answer:

please give me brainlist and follow

Explanation:

fallopian tube

Fertilization usually takes place in a fallopian tube that links an ovary to the uterus. If the fertilized egg successfully travels down the fallopian tube and implants in the uterus, an embryo starts growing.

Other Questions
PLEASE HELP I WILL GIVE BRAINLIEST IF YOU DO BOTHplease give me a real answer Read the following excerpt from The Jungle Book by Rudyard Kipling."That is why, he said, shifting his paw on the leaves. "Not even I can look thee between the eyes, and I was born among men, and I love thee, Little Brother. The others they hate thee because their eyes cannot meet thine; because thou art wise; because thou hast pulled out thorns from their feetbecause thou art a man.Which detail helps create the pace and mood in this excerpt?a I was born among menb and I love theec thorns from their feetd shifting his paw on the leaves 1. Compare and Contrast How were the civilizations of ancient Egypt and Kush both similar and different? What is the median of the data What are some other ways other than quotes, to state your evidence in an essay? In a few days, I will be taking a state exam that will require me to write either an informative or argumentative essay. Please take note, that I am in the 8th Grade. Which sentence most clearly makes an ethos appeal?A. Most dentists agree that flossing is just as important as brushing.B. People who oppose the funding of libraries should feel ashamed.C. Statistics show that most Americans oppose the ElectoralCollege.D. Giving students the option to eat healthy is just common sense y = 2x - 4y = - 2x + 8 Math What is the constant of proportionality in the table below? During facilitated diffusion, molecules pass through the cell membrane with the help of?- proteins, - lipids, - water .Four different cellular phone plans are shown below. Plan 1 charges $0.35 per minute with no monthly fee.Plan 2 charges a monthly fee of $10.00 plus $0.25 per minute. Plan 3 charges a monthly fee of $59.95 with 200 free minutes.Plan 4 charges a monthly fee of $15.00 plus $0.20 per minute.Which plan is the least expensive for 200 minutes of cellular phone use?.A. Plan 4B. Plan 3C. Plan 1OD. Plan 2 17.Which pair of numbers is relatively prime? *7 & 214 & 156 & 99 & 27 can someone please help me find the slope on khan academy? and please provide an explanation if possible "Peter promptly prepared the spicy peppers" is an example of... alliteration onomatopoeia hyperbole simile 6Which issue first led to war between Rome and Carhage?A the ability to get whear from EgyptB the right to start colonies in Spainthe use of chariots in warfarecontrol of trade in the MediterraneanPlssss I give the brainliest Please help I'll give brainliest 4. To promote diversity, companies actively seek and promote individuals in all of the following areasexcept1. educational levels.2.ages 3. Races 4. National origins Imagine something fantastic and begin to write a story about this subject using hyperbole and language that conveys mood. Be mindful of what kind of feeling or what sort of mood you want your readers to experience. Can anyone help with what the formula to calculate the volume of a Rhombohedron (3D Rhombus) is? Could you also give me an example of how to do it please? Match the term to its definition. (4 points)Column A1.Neap tide:Neap tide2.Spring tide:Spring tide3.Tidal bulges:Tidal bulges4.Tides:TidesColumn Ba.tide where there is the greatest difference between high and low water levelsb.the rise and fall of sea levels due to gravitational forcesc.tide where there is the least difference between high and low water levelsd.two ocean bulges created on opposite sides of Earth due to the moon's gravitational pull and the ocean's resistance to the pull What is so important about DNA? Select all correct answers.A. DNA is found in all organisms and carries instructions to build those organismsB. DNA found in one organism probably shares similar instructions found in another speciesC. DNA is composed of only four bases that repeat in a sequence that is different for eachspeciesD. Some organisms don't actually have DNAE. The DNA of each organism is made out of different types of chemicals