In his "Four Freedoms" Speech to Congress, President Franklin Roosevelt calls for the end of human oppression and the beginning of universal liberty. Which sentence from the passage best support this analysis?

Answers

Answer 1

Answer:

“The world order which we seek is the cooperation of free countries, working together in a friendly civilized society”.

Explanation: Its correct

Answer 2

From the passage, the sentence that best supports this analysis is:

The first is freedom of speech and expression—everywhere in the world.

What was the objective of Roosevelt's speech?

The 1941 State of the Union Address by Franklin D. Roosevelt, is also referred to as the "Four Freedoms" speech. In it, he presented a stirring picture of a society in which everyone lived in freedom—freedom of expression, freedom of religion, freedom from want, and freedom from fear.

It was presented and it had a significant impact on history.

The complete information about the passage is given below:

Select the correct text in the passage.

In his "Four Freedoms" Speech to Congress, President Franklin Roosevelt calls for the end of human oppression and the beginning of universal liberty. Which sentence from the passage best support this analysis?

from Roosevelt's "Four Freedoms" Speech

The first is freedom of speech and expression—everywhere in the world.

The second is freedom of every person to worship God in his own way—everywhere in the world.

The third is freedom from want—which, translated into world terms, means economic understandings which will secure to every nation a healthy peacetime life for its inhabitants—everywhere in the world.

The fourth is freedom from fear—which, translated into world terms, means a world-wide reduction of armaments to such a point and in such a thorough fashion that no nation will be in a position to commit an act of physical aggression against any neighbor—anywhere in the world.

That is no vision of a distant millennium. It is a definite basis for a kind of world attainable in our own time and generation. That kind of world is the very antithesis of the so-called new order of tyranny which the dictators seek to create with the crash of a bomb.

To that new order we oppose the greater conception—the moral order. A good society is able to face schemes of world domination and foreign revolutions alike without fear.

Since the beginning of our American history, we have been engaged in change—in a perpetual peaceful revolution—a revolution which goes on steadily, quietly adjusting itself to changing conditions—without the concentration camp or the quick-lime in the ditch. The world order which we seek is the cooperation of free countries, working together in a friendly, civilized society.

This nation has placed its destiny in the hands and heads and hearts of its millions of free men and women; and its faith in freedom under the guidance of God. Freedom means the supremacy of human rights everywhere. Our support goes to those who struggle to gain those rights or keep them. Our strength is our unity of purpose.

To that high concept there can be no end save victory.

Hence, From the passage, the sentence that best supports this analysis is:

The first is freedom of speech and expression—everywhere in the world.

Learn more about  Roosevelt's speech:

https://brainly.com/question/832342

#SPJ2


Related Questions

What role did the railroads play in bringing immigrants to the
United States and to Washington?

Answers

Answer:

the role they played was traveling and getting material to other countries.

Explanation:

Which showed that the economy was weaker than the stock market indicated during the 1920s

Answers

Answer:

Bankruptcy of farmers" showed that the "economy" was weaker than the "stock market" indicated during the "1920s

Explanation:

brainliest plzzzzzz

Answer:

When farmers went bankrupt

Please mark me as the brainliest if I helped you. I really need it

Choose all of the items that correctly describe action taken during the Progressive Era.
a.) Medicaid
b.) 17th Amendment
c.) Social Security Act
d.) Pure Food and Drug Act
e.) Creation of National Forest Service

Answers

Answer: B)17th Amendment

D)Pure Food and Drug Act

E)Creation of the National Forest Services

Explanation:.

Government powers were expanded in the workplace rights, children's rights, and women's rights throughout the progressive age.

Options B, D, and E are the correct answers because the actions that were taken during the era was;

By allowing Americans to directly elect U.S. senators, the 17th Amendment helped to eliminate corruption and limit the dominance of political machinery.

The Pure Food and Drug Act (FDA) established the nation's first consumer protection agency, the Administration, by prohibiting and restricting the interstate sale of misbranded or contaminated food and medications.

The Forest Service was created by congressional legislation in 1905, during Theodore Roosevelt's presidency and at the peak of the Progressive Era.

For more information regarding the progressive era, refer to the link:

https://brainly.com/question/14659104?referrer=searchResults

1
Select the correct answer.
Why is the Louisiana Purchase treaty an important document in the study of Manifest Destiny?

Answers

I don’t know your options but I would put yes. But this depends what destiny is labeled to be, but it standard speech and though of history it should be Yes. 1-1=0
The Louisiana Purchase treaty is an important document in the study of Manifest Destiny because it shows the extent to which the United States was claiming land westward.

What is the message of this poster?

Answers

I believe A because there’s only a man there and no woman plus he’s carrying a suit meaning he’s joining the army. i could be wrong tho sorry

In the system of sharecropping in the South, many sharecroppers
O made enough profit to acquire larger plots of land.
O were unable to make a profit due to their debt.
O lost harvests because they lacked equipment.
O found that cotton was no longer a cash crop.

Answers

Answer:

B pretty sure

Explanation: B because they became a sharecropper because of debt in the first place and when they were there their owners wouldn't give them much of a salary at all and they legally couldn't sell their own crops.

Answer:

B

Explanation:

70. What natural disasters led to the downfall of the Minoans?

Answers

Answer:

Volcanic explosion. Three and a half thousand years ago, the tiny Aegean island of Thera was devastated by one of the worst natural disasters since the Ice Age - a huge volcanic eruption. This cataclysm happened 100km from the island of Crete, the home of the thriving Minoan civilisation.


Imagine that an exchange student from China visits your class. While your teacher discusses how the United States has a limited government,
the Chinese student raises his hand and asks why the government has limited power. Which point best highlights why the US government has
limited power?
A.
A limited government means citizens pay fewer taxes.
B.
A limited government helps people avoid breaking the law.
C.
A limited government protects individual freedoms.
D.
A limited government prevents businesses from being too powerful.

Answers

Answer:

C

Explanation:

Answer:

C. Limited government protects individual freedoms.

Explanation:

In a non-limited government, there are no checks and balances. Checks and balances keep the government in check and protect the rights of the citizens.

a cease-fire
A. republic of liberia
B. lusitania
C. Whites
D. Sun Yat-sen
E. armistice
F. Zionists
G. imperialism
H. Triple Alliance
I. William Mckinley
J. Triple Entente.

Answers

Answer:

Answer: a

answer: a

jshshsgshsheuvsusuzhzhisbxjzzhzhzizjz

Katrina is starting her own business producing all-natural beverages. She must use
to create her product.

The water that she is using to create her beverage line is an example of
.

The number of employees required to produce her beverage line is an example of
.

The rent money she pays for a factory to produce her beverage line is an example of

Answers

Answer:

Explanation:

Resources

Land

Labor

Capital

Answer:

Resources, land, labor, capital

Explanation:

2021 edge:)

In the (blank) nationalist uprisings swept across China, India, and Turkey

This movement was a strong response to Western (blank)

For all three countries, the rise of nationalism resulted in (blank)

Answers

The rise of nationalism resulted in self-government in all three countries.

Nationalist movements caused social upheaval in the three countries

Nationalism resulted from a rejection of imperialism and Western rule.

Strong leaders emerged and greatly affected nationalist movements. I

Answer:

1. "early 1900's"

2. "imperialism"

3. "independence"

edge 2021

What is the x-value of point A?​

Answers

Answer:

is there any options our is this just the question

What continent is the Great Wall of chin in

Answers

Asia.

Explanation:

The great wall of China stretches from west to east in northern China ,Asia.

Was it necessary for Santa Anna to kill all of the Texans or was there a better way to handle the situation?

Answers

Answer:

yes

Explanation:

santa ana couse have made an agreement on texans that she wants peace no war

Should the United States fight wars to advance democracy around the world?

Answers

Answer:

no becua

se the pres wouldent have any troops left for the milatary

Explanation:

Answer:

no not at all so yeah it said this needs to be 20 characters long

Why do citizens have to register to vote

Answers

Answer:

In order to make elections fair and to ensure there is no fraud, voters need to register so that the vote counters can make sure they only vote once. This process is used at the local, state, and federal levels.

Explanation:

Answer:

I'm not very familiar with these kind of things but I'm guessing the reason is because there won't be any "fake electors" as in corrupted ballots and yk stuff like that...


Describe two features of the attempts to colonise Virginia in the 1580s.

Answers

Answer:

The famous Sir Walter Raleigh was given permission by Queen Elizabeth the first to establish colonies in the Americas. Naming the land 'Virginia', after the virgin queen, the colony was set to challenge Spanish Imperial interests. However, the settlers had disputes with their indigenous neighbours, and the disappearance of many of the settlers of the second attempt is attributed to the conflict.

What happened during the Seattle riot of 1886?

A) Angry mobs forced all immigrants to move out of the state.
B) Angry mobs drove Chinese immigrants out of their homes.
C) Chinese immigrants were persuaded to leave peacefully.
D) Chinese immigrants drove Americans out of their homes.

Answers

Answer:

B) Angry mobs drove Chinese immigrants out of their homes.

Explanation:

(Just took the quiz)

During the Seattle riot of 1886 Angry mobs drove Chinese immigrants out of their homes. Thus the correct option is B.

What is the Seattle riot of 1886?

During a hard struggle between labor and capital in the Western United States, the Seattle riot of 1886 took place in Seattle from February 6–9 of that year. It was triggered by fierce labor competitiveness.

As early as the 1860s, violent outbursts were directed at Chinese people living in America. In addition to seriously injuring two militia members and three rioters, the incident forced over 200 Chinese civilians out of Seattle.

When Chinese workers began working in urban areas instead of digging and building railroads, conflicts in Seattle only got stronger. The organized movement against Chinese laborers in Seattle was led by members of the Knights of Labor.

Therefore, option B is appropriate.

Learn more about the Seattle riot of 1886, here:

https://brainly.com/question/4189376

#SPJ7

Which statement best compares Anne and Margot Frank in Anne Frank: The Diary of a Young Girl?


Anne is more forward and outspoken than Margot.


Margot is less intelligent and intellectually motivated than Anne.


Margot is not as well liked by the annex residents.


Anne is quieter and more reserved than Margot.

Answers

A is the answer. Hope this helps!

Answer:

A

Explanation:

trust

Explain the differences between the roles of consumer, citizen, and worker. Your answer​

Answers

Answer:

"A citizen is one who is a participant in a democracy, regardless of their legal status. A consumer is one who has surrendered to others the power to provide what is essential for a full and satisfied life.A worker (for workers compensation purposes) is a person who is engaged to perform work under a contract of service (as defined by the Return to Work Act 2014 (the Act))."

Explanation:

Risk*

The differences between a consumer and a citizen are in which one's advocacy and moves lie. A patron seems out for individuals through the market. A purchaser makes accountable decisions in which they invest their money. this may be the difference between shopping for neighborhood fruits alternatively than buying foreign grown.

What is the position of a citizen as a consumer?

The client as a citizen is a person who makes purchasing preferences in respect of the sustainable development of the sector community. Environmental protection, social duty, and labor security end up his main criteria main the act of purchasing.

Learn more about consumers here: brainly.com/question/911984

#SPJ2

amendment requiring due process on the national level.


A) Fifth amendment

B) Third amendment

C)Dred Scott v. Stanford

D)Miranda V Arizona

E)Procedural due process

F)14th amendment

Answers

Answer:

Due to Low point, i am not able to asked questions... so i have leave comment here

the answer is......The Fifth Amendment


What are the wonders of the world, and how does humankind match up and overcome them? How does Sophocles illustrate human mastery and control over the
environment?

Answers

Explanation:

All of the wonders on the list are UNESCO World Heritage sites and were chosen by an online poll of tens of millions of votes in 2007. If you couldn't name all seven (but hopefully now you can), then naming the Ancient Seven Wonders of The World could prove even more difficult

What types of rules did leaders of agricultural societies enforce?


Leaders established laws about which villagers were allowed to trade.

Leaders encouraged disorder as a way of keeping their power in the village.

Leaders told which villagers were allowed to build permanent houses and where.

Leaders developed laws about storing grains and other supplies to prepare for disasters.

Answers

Answer:

A

Explanation:

Did it on edge

Leaders of agricultural societies enforce  laws about which villagers were allowed to trade. The appropriate response is option A.

What are the characteristics of agricultural societies  ?

The first society founded at the time of the earliest human settlers was the Agricultural Society. The Agricultural Society had established itself together with the earliest nomads some 10,000 years prior.

Because the early immigrants were largely farmers or hunter-gatherers, the Earliest Agricultural society expanded. The early inhabitants were reliant on agriculture and farming. They were reliant on the system of agriculture.

Its defining feature is that agriculture is at the core of the economy, wealth, and society in general. The main instruments used in agricultural production are human and animal labor. Members of agrarian communities specialize in particular tasks and there is a division of labor.

To learn more about agricultural societies

https://brainly.com/question/1408571

#SPJ2

What was the main purpose of the three neutrality acts passed in the United States from 1935– 1937?

Answers

Answer:

The Neutrality Acts were laws passed in 1935, 1936, 1937, and 1939 to limit U.S. involvement in future wars. They were based on the widespread disillusionment with World War I in the early 1930s and the belief that the United States had been drawn into the war through loans and trade with the Allies.

Explanation:

Answer:to keep the United States out of another world war

Explanation:

took the mid year

PLease help me answer this !!!

Answers

Answer:

Explanation:

The U.S. prepared for war by first building- up the military in readiness for deployment, by initiating a draft. President Woodrow Wilson sought Congress support in the declaration of war against Germany. ... Businesses and citizens were strongly urged to support the war through government and media communications.

What are some benefits of countries to make pipelines?

Answers

Answer:

Pipelines are an important industry to Canadians, providing jobs in communities large and small, as well as considerable tax revenues. Pipelines also contribute to our prosperity when we export oil and gas to other countries.

Explanation:

Which of the following describes the Africa diaspora that resulted from the slave trade

Answers

Answer:

This is a largely the result of a tumultuous period in history in whitch africans were scattered abroad y the pressures of plantation slvery and the ideologies associated with white supremacy.

Explanation:

Answer Choices:

What is the African Diaspora?

A. The trade between the Americas, Africa, and Europe that included the trade of enslaved persons

B. The spreading of people of African descent throughout the world due to forced migration

C. The population of Africans who were captured and taken to Europe in the fifteenth century

D. The voyage from Africa that carried enslaved Africans to the Americans

Answer:

B. The spreading of people of African descent throughout the world due to forced migration

Explanation:

"'The African Diaspora'

The transatlantic slave trade led to one of the largest global, forced migrations in history. During the slave trade, around 12.5 million Africans were displaced from their homes and sent to the Americas to work on tobacco, cotton, and sugar plantations. In addition, there were many Africans who were forcibly taken to Europe in the fifteenth and sixteenth centuries. As a result of these forced migrations, populations of people of African descent grew in both Europe and the Americas. These populations became known as the African Diaspora. Depending on where these populations lived, they had very different experiences integrating into their new societies." (PF World History L3 PDF, pg. 38)

Written confirmation supporting that answer B. [The spreading of people of African descent throughout the world due to forced migration]  is CORRECT.

I hope this helps! (✿◠‿◠)

#pennfosternotes ⭐⭐⭐⭐⭐

Describe a common person who typically was accused of witchcraft. Why were they picked out?

Answers

Answer:

Primarily by teenage girls such as Elizabeth Hubbard, 17, as well as some who were younger. Dorothy Good was four or five years old when she was accused of witchcraft.Explanation:.

What do you think would be an economic(money) reason a country would take over another? What do you think would be a religious reason?

Answers

Answer:

Religious beliefs matter for economic outcomes. They reinforce character traits such as hard work, honesty, thrift, and the value of time. Otherworldly compensators — such as belief in heaven, hell, the afterlife — can raise productivity by motivating people to work harder in this life.

WHY IS DRAKE SO FRGGIN COOOLIO ??? LIKE I LOVE HIM HAHAHAH ANYWAYS I NEED HELP ANS FRIEDNDSS HAHAHAHA

Answers

A limited amount of written records survived to shine light on this time period

Answer:

tee hee

Explanation:

Other Questions
Answer please I need this quick !!!! At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? a pulley is used to lift a 2000 N safe over frosty's head. the safe is lifted 6m in 4s by Rudolph. how much power did Rudolph use? what does hi mean in spanish How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please!