In ΔGHI, the measure of ∠I=90°, the measure of ∠G=76°, and IG = 6.2 feet. Find the length of HI to the nearest tenth of a foot.

Answers

Answer 1

Answer: 24.9

Step-by-step explanation:

6.2 tan(76) = 24.86

Answer 2

Answer:

the answer is 24.9

Step-by-step explanation:


Related Questions

if f(x) = x+5 then fill the table
x| 1 | | 2 | |
y| | 3 | |5 |​

Answers

Answer:

6,-2,7,0

Step-by-step explanation:

Use the equation and plug in values

f(1)=1+5

y=6

--

3=x+5

x=-2

--

f(2)=2+5

y=7

--

5=x+5

x=0

Nina mixes 200 mL of cranberry juice, 300 mL of grapefruit juice,and 700 mL of spring water to make fruit punch. What is the ratio of cranberry juice to grapefruit juice to spring water

Answers

200 : 300 : 700 I think?

Help please!!! I don’t knowwwwwwwww

Answers

Answer:

4th dot

Step-by-step explanation:

because

What is the volume of a cylinder, in cubic m, with a height of 6m and a base diameter
of 18m? Round to the nearest tenths place.

Answers

Answer:V= 1526.8m3

Step-by-step explanation: pi (9)2(6)

A cylinder is a three-dimensional structure formed by two parallel circular bases. The volume of a cylinder, in cubic m, with a height of 6m and a base diameter of 18m is 1526.814.

What is a cylinder?

A cylinder is a three-dimensional structure formed by two parallel circular bases connected by a curving surface. The circular bases' centres overlap each other to form a right cylinder.

Given the height of the cylinder is 6m, while the base diameter is 18m. Therefore, the volume of the cylinder can be written as,

Volume of cylinder = (π/4)×d²×h = (π/4)×18²×6 = 1526.814m³

Hence, the volume of a cylinder, in cubic m, with a height of 6m and a base diameter of 18m is 1526.814.

Learn more about Cylinder:

https://brainly.com/question/12248187

#SPJ2

8-1 and 1/2 show your work

Answers

Answer:

The answer is 6.5

Step-by-step explanation:

I seem to be getting my questions wrong or be going on the wrong trail. Can someone help me decode this?

Answers

Answer:

A=4

B=3

C=2

D=1

Step-by-step explanation:

Data that's displayed randomly on a scatter plot graph illustrates

positive correlation.

negative correlation.

none of these.

no correlation.

Answers

ANSWER

NO CORRELATION

Right answers will get brainliest!

Answers

Answer:

42 = C (y ≤ 2)

43 = G (-x + 4x - 2)

44 = B (Its axis of symmetry is x = 14)

45 = H (x = 2)

ILL MARK U BRAINLIEST

Answers

i think its 107

Step-by-step explanation:

you multiply 11x7 then 6x5 then you add the answers from those

answer:

113 ft2

explanation:

7 • 5 = 35
11 - 5 = 6
7 + 6 = 13
13 • 6 = 78
35 + 78 = 113

Find the output, y, when the input, c, is 6. HELP ASAP

Answers

try 8 homie because 8 is on the y axis when 6 is on the x

Convert to pints: 10 quarts
20 pints
1 pints
100 pints
5 pints

Answers

Answer:

20

Step-by-step explanation:

20 pints because your convert 10 quarts into pints

Answer:

i think 100 pints

f(x)=x^2-4 need help​

Answers

NHDHDHDHDUDIDIDIDIDIFUFUTURURURURURURURURURURURURURUTURURYRYRYRYRYDYRYRYYRYRURYFRF

Kate wanted to sell a box of candy bars to raise money for her team. She sells 1/4 of the box at school. And 1/2 of the box to her neighbors. What fraction of the candy bars dose kate still have to sell. Put your answer in simplest form

Answers

Answer: 1/4

Step-by-step explanation:

Fraction of the box of candy bars sold at school = 1/4

Fraction of the box of candy bars sold to neighbor = 1/2

Therefore, the fraction that she has sold already will be:

= 1/4 + 1/2

= 1/4 + 2/4

= 3/4

The fraction of the candy bars that Kate still have to sell will be:

= 1 - 3/4

= 1/4

Kate has 1/4 candy bars left to sell

Pls help me somebody plzzz

Answers

Answer:

the answer is

X + 40 + 155 =180

Have a cute puppy!! It’s my puppy

Help me, please I beg you

Answers

ALthough I'm not 100% sure, I think it may be either because the points don't continue and stop short, or the lack of connection between the choices. I hope this helps in some way

18 is 14 percent of what?

Answers

Answer:

18 is 14% of 128.5714

Step-by-step explanation:

it's 77.78

Step-by-step explanation:

14: 18*100 =

(14*100): 18 =

1400: 18 = 77.78

Now we have: 14 is what percent of 18 = 77.78

Question: 14 is what percent of 18?

Percentage solution with steps:

Step 1: We make the assumption that 18 is 100% since it is our output value.

Step 2: We next represent the value we seek with $x$x.

Step 3: From step 1, it follows that $100\%=18$100%=18.

Step 4: In the same vein, $x\%=14$x%=14.

Step 5: This gives us a pair of simple equations:

$100\%=18(1)$100%=18(1).

Step 6: By simply dividing equation 1 by equation 2 and taking note of the fact that both the LHS

(left hand side) of both equations have the same unit (%); we have

$\frac{100\%}{x\%}=\frac{18}{14}$100%x%=1814

Step 7: Taking the inverse (or reciprocal) of both sides yields

$\frac{x\%}{100\%}=\frac{14}{18}$x%100%=1418

$\Rightarrow x=77.78\%$⇒x=77.78%

Therefore, $14$14 is $77.78\%$77.78% of $18$18.

What is the domain of the function?

Answers

Answer: -6 ≤ x < 4

Step-by-step explanation:

Open circles on a graph mean that that point is not included

Filled in circles on a graph mean that that point is included

As a result, the end point (-6, -6) is included while (4, 8) is not

The domain is all possible x-values so the graph can be anywhere from:

-6 ≤ x < 4

Note that there are no possible values for the x-value of 4

PLZ use the information given to write the equation of the circle.
Center: (0,-16), Radius: √15


A: x2+(y+16)2 = 15−−√

B: (x+16)2+y2=15

C: x2+(y+16)2= 15

D: x2+(y−16)2 = 15

Answers

Answer:

x^2+(y+16)^2=15

Step-by-step explanation:

(x-0)^2+{y-(-16)}^e=(√15)^2

→x^2+(y+16)^2=15

Answer:

C. x² + (y + 16)² = 15

Step-by-step explanation:

Equation of circle:

(x - h) + (y - k) = r², where (h, k) is the center and r is the radius

We have:

h = 0, k = -16, r = √15

Substitute the given into the equation above and get the equation of the given circle:

(x - 0)² + (y - (16))² = (√15)² ⇒x² + (y + 16)² = 15

Correct choice is C

I need help or I will fail

Answers

4 is the correct anwser

standard deviation of the data. 221,228,218,319,224​

Answers

Answer:

Population: 38.64. Sample: 43.20

A scientist began a study with a sample of 1,500 bacteria. He noticed that
the number of bacteria in the sample after t days can be modeled by the
equation P=1,500.5. In this equation, what does 5t represent?
A. The number of bacteria increases by a factor of t each day for 5 days.
B. The number of bacteria increases by t bacteria after 5 days.
C. The number of bacteria increases by 5 bacteria each day.
D. The number of bacteria increases by a factor of 5 each day.

Answers

Answer:

C

Step-by-step explanation:

plsss help i’ll give brainliest if you give a correct answer

Answers

Answer:

(-2) and 3 and (-4)

Step-by-step explanation:

Answer:

1, 3, and 4

OR

A, C, and D

Step-by-step explanation:

The inequality is f is LESS THAN 4.

-2 is less than 4

7 is GREATER than 4 so this is incorrect

3 is less than 4

-4 is less than 4

what kpop dances do you recommend to help you , lose weight?
My sister was asking but i didnt know how to answer her..

Answers

Answer:Wonder Girls-Like This. Perfect workout, especially for your inner thighs! ...

Sistar-Loving You. Another great leg workout. ...

Sistar-Touch My Body. Very fun and lighthearted. ...

Sistar19-Ma Boy. Same. ...

Secret-Madonna. I love this dance, it's a classic on my workout routine. ...

Secret-Love Is Move. ...

Hyuna-Bubble Pop. ...

Step-by-step explanation:

Factor completely 49x2 − 9.

(7x + 3)(7x − 3)
(7x + 3)(x − 3)
(7x − 3)(7x − 3)
(7x − 3)(x − 3)

Answers

Answer:

number 1

Step-by-step explanation:

faster way to it to try to multiple the first to the 2nd one .

(7x+3)(7x-3)

( 7x .7x - 7x.3 ) + ( 3 .7x - 3.3)

49x^2 -21x + 21x - 9

it take you back to the original equation

Answer:

A is correct

Step-by-step explanation:

What is the measure of angle RTV?

Answers

Answer:

25 degrees

Step-by-step explanation:

70 degrees times 2 to get 140 for the outside arc on the left, then add 140 plus 90 plus 80 to get 310, then do 360-310 to get 50, then divide that by 2 to get angle RTV which is 25 degrees.

3x2 equals..WHAT DOES IT EQUAL

Answers

Answer:

6

Step-by-step explanation:

OOO OOO = 6

Find x and y with ray theorem

Answers

Answer:

x = 12 and y = 9

Step-by-step explanation:

Using the similarity theorem to fid the value of x and y

16/x = 16+6/16.5

16/x = 22/16.5

22x = 16*16.5

22x = 264

x = 264/22

x =12

Similarly

24/x = 24+y/16.5

24/12 = 24+y/16.5

2 = 24+y/16.5

24+y = 2 * 16.5

24+y = 33

y = 33-24

y = 9

Hence x = 12 and y = 9

Factor completely. 492 – 9 =?​

Answers

Answer:

483

Step-by-step explanation:

Answer:

483

Step-by-step explanation:

subtract 492 by 9 and it is =483

R varies inversely with x. If R= -2 when x = 6, what is the value of R when x = -3?
Ο Α. -1
0 B 4
O C.-4
OD. 1

Answers

Answer:

R=x = R= −2 =x =6 =R =x =− 3=

Step-by-step explanation:

Which expression is equivalent to the expression -3(4x - 2) - 2x?
Answers:
-8x
-16x
-14x - 2
-14x + 6

Answers

Answer:

-14x+6

Step-by-step explanation:

we distribute -3 in to get:

-12x+6-2x

Combine like terms

-14x+6

Other Questions
Given the definitions of f(c) and g(x) below, find the value of g(f(5)).f(x) = 2x 10g(x) = x2 + 6x 8 Please help me with this question Need Help ASAP Thanks so much in advance... 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 What two numbers have a sum of 215 and a difference of 137 work out 56 - 8 2 what is the order from least to greatest(38%,3/8,0.4,1/3,41%,0.33) John ate three hot dogs at a hot dog eating contest in 45 seconds. How many hot dogsshould he be able to eat in the 5 minute contest limit? show work Hellohello, if you able to help me then please do. (: Carol Beal is the export manager at Gudrun Sjoden USA, a licensed distributor for a Swedish designer. Carol has North America and all of Asia in her territory. She has just formed a joint venture to run retail branches in Tokyo, Shanghai, and Seoul. Her plan is to ship directly from the Gudrun Sjoden warehouse in Stockholm. Her Asian partner has requested she ship to her DDP, but Carol would prefer to ship Ex Works. Carol knows that there are critical differences between the two terms of sale and is reviewing what decision to make. She wants to keep her U.S. expenses as low as possible, and she would be funding the shipping out of the United States. She also wants to continue to build a good, solid, trusting relationship with her joint venture partner.Which statement is true Carol ships goods Ex Works? a. The buyer would cover shipping and insurance costs assume the risk the door. b. The seller would cover all insurance costs while the buyer would cover the cost of shipping. c. The goods be shipped from Stockholm at the seller's expense. d. The seller would cover all shipping and insurance costs and assume the risk at the factory door. e. The buyer would cover all insurance costs while the seller would cover the cost of shipping 2.95___2.949 which is greater I need help what's the answer anyone? 4) A drag racer starts her car from rest and accelerates at 10.0 m/s for a distance of 400 m (1/4 mile). (a) How long did it take the race car to travel this distance? (b) What is the speed of the race car at the end of the run?