In 1619 a Dutch trader exchanged his cargo of African for food at which of the following English settlements

Answers

Answer 1

Answer:

The answer is Jamestown

Answer 2

Answer:

The answer is jamestown

Explanation:


Related Questions

What country in asia is located farthest north?

Answers

It is Russia. Hope this is right

what is one true statement about money ?

Answers

Answer:

Explanation:

Answer:

money is a mean of exchange of good and services.

1.money is mobile

2.money is transparent

in the cube column because
I put the.

Answers

what cube column? you must of forgot to add an imagine

give and motivate your opinion does the guest have the right to mention things they are unhappy about their hotel rooms​

Answers

Answer:

Yes, if the person themselves are paying for it, it also depends on how picky you're being and who your complaining to.

which 5 strategies can You employ to ensure that you as a student you will not drop out of university​

Answers

Answer:

*study

*get motivated

*  find friends so you will be less likely to leave

*do something you want to do

*have fun

* go to a university you want to go to

Explanation:

Based on the maps, why is the population density so low in the western half of China?

What type of government does North Korea have?

Answers

I dont know the first answer but for the second answer, dictatorship.

Why are people are more serious in population management in comparison of previous day ?​

Answers

Answer:

Because of the rapid growth increase was mainly caused by a decreasing death rate (more rapidly than birth rate), and particularly an increase in average human age.

Explanation:

Please develop a two-page case write-up that includes the following three elements:
1. Problem statement
Define the problem that Haier faces and that you address in the write-up; conclude the first paragraph with the question and explain why the question is important.
2. Analysis
Keep focused on the question raised; indicate factors that are important for answering the question and discuss the relationships between them.
3. Recommendations
Offer recommendations for Haier that should follow logically from your analysis; discuss implementation issues.

Answers

Answer:

Higher wage of labor and cost of production.

Explanation:

Higher wage and cost of production are the problems faces by Hair because due to higher cost of production, the cost of Hair appliances are also very high which lowers its demands, while on the other hand, Whirlpool launches appliances that has low cost than Hair appliances so people go for Whirlpool appliances which is a big problem. The solution of this problem is that the Hair company shift their set up in that country where wages are low as well cost on production, in this way the Hair can solve its problem.

How does farming affect the Earth's systems? Choose all the right answers


A. fertilizer runs off the fields and into rivers



B. exhaust from farming machines pollutes the air


C. the land the farm was on cleared away other ecosystems




D. cows give off methane gas that gets in the atmosphere


Answers

Answer:

um I think it's C

Explanation:

pls Mark brainiest answerer pls

Who wanted Quebec to separate from canada? Please explain in full sentences

Answers

Answer:

Answer:

At a federalist rally of about 12,500 people which was held at the Verdun Auditorium on October 24

Explanation:

Charest further emphasized his commitment to constitutional reform if a "No" victory was achieved.

Explanation:


The territory acquired in the Mexican-American War is called the



Answers

Answer:

It ended the war, and Mexico recognized the Mexican Cession, areas not part of disputed Texas but conquered by the U.S. Army. These were northern territories of Alta California and Santa Fe de Nuevo México. ... The question of how to treat the new acquisitions also intensified the debate over slavery in the United States

Explanation:

i hope you understand better

Answer:

its the second drop down

Explanation:

What are the roles and duties of the secretary of the Senate? Check all that apply.

maintaining all Senate documents
ensuring that procedures and rules are followed
setting meeting times for senatorial secessions
keeping a journal of all events that take place in the Senate
assuming the duties of the Senate president in the event of absence, death, or disability

Answers

Answer:

maintaining all Senate documents

ensuring that procedures and rules are followed

keeping a journal of all events that take place in the Senate

a b d

Explanation:

PLEASE MARK BRAINLIEST!!!!!!!!!!!!!

Answer:

maintaining all Senate documents

ensuring that procedures and rules are followed

keeping a journal of all events that take place in the Senate

True or False: Disease in the circulatory system does not affect other organ systems, such as the muscular system. *
True
False

Answers

False answer it does transfer

Answer:

False

Basic fact:

the circulatory system is a system that contains the heart and the blood vessels and moves blood throughout the body

Explanation:

since it is a heart and blood vessel it moves blood around the body

if there is a disease in there it spreads all around the body through the blood

The American Board of Criminalistics offers _____ to biologists.
A. Certification if requirements are met
B. Pay
C. Certification if requirements are not met
D. Special cases

Answers

Answer: A

Explanation:

Answer:

The American Board of Criminalistics offers _____ to biologists.

paycertification if requirements are not metcertification if requirements are met <<<<CORRECTspecial cases

Explanation:

2022 Forensic Edge

how will one adapt from ones post school social routine to minimize the impact that social pressures may have on your academic or work performance,?​

Answers

Answer:

need points sorry

tell other

Explanation:

ahjajajajajajjajajajajs

HELP IF U HELP U GET BRAINLIEST ANSWER THIS IS 30 POINTS

Answers

Answer:

introducing tax cuts to stimulate the economy

What was Alexander the Great's biggest legacy over the lands he conquered?

Answers

Answer:

United the Greek city-states, and Alexander destroyed the Persian Empire forever.

Alexander's conquests spread Greek culture, also known as Hellenism, across his empire.

Explanation:

Which of the is not a characteristic that helps to classify rocks?

Answers

Answer:

Where is a pic... Rocks are "earthly" or "organic" you could say.

Explanation:

Why was Mussolini expelled from the Socialist Party in Italy?

Answers

Mussolini was expelled from the Socialist Party in Italy because he was in support of Italy’s intervention in War during WWI while the Socialist Party in Italy were against Italy being involved in the war.

plz help me now.... (≧∇≦)/​

Answers

Answer:

The correct answer is Option C.

Explanation:

1) Simplify 9/60 to 3/20.

[tex] \frac{x}{24} - \frac{x}{30} = \frac{3}{20} [/tex]

2) Simplify x/24 - x/30 to x/120.

[tex] \frac{x}{120} = \frac{3}{20} [/tex]

3) Multiply both sides by 120.

[tex]x = \frac{3}{20} \times 120[/tex]

4) Use this rule: a/b × c = ac/b.

[tex]x = \frac{3 \times 120}{20} [/tex]

5) Simplify 3 × 120 to 360.

[tex]x = \frac{360}{20} [/tex]

6) Simplify 360/20 to 18.

[tex]x = 18[/tex]

Therefor, the answer is option C. 18.

Which of the following is an accurate statement about the voter turnout rate in the United States?

a. There is usually no difference in participation rates between presidential and midterm elections.
b. Presidential election years usually have significantly higher turnout than in midterm election years
c. Voters are more likely to vote in congressional races in midterms than when presidents are running.
d. More voters turn out to vote in elections where less money is spent to advertise campaigns.

Answers

Answer:

c

Explanation:

what are the disadvantages of bartering​

Answers

Answer:

Explanation:

One disadvantage is Lack of Divisibility.

What was science's role in the Industrial Revolution?

Answers

Answer:

Scientific approaches helped inventors develop their inventions by conducting experiments (which were controlled by the scientific method)

Explanation:

answer I think is most correct gets marked brainly ist

Answers

I think the answer is B

Which of the following is MOST dependent on the ability to exchange currencies?
A investing in capital goods
B
protecting domestic industries
С
encouraging entrepreneurship
D
engaging in international trade

Answers

A I’m pretty such that’s right
The answer would be A.

Sending a reporter into a storm area that has been evacuated ______.

is known as disaster fatigue.
is an invasion of privacy and therefore not newsworthy
is okay and newsworthy.
is known as ethnocentrism.
is too dangerous just for the sake of promoting ratings.
is questionably newsworthy because it brings celebrity status to the culprit.

Answers

Answer:

is too dangerous just for the sake of promoting ratings.

Discuss the roles of the three spheres of government in a democratic country

Answers

Answer search it now it shows best result

Explanation:

Generating Win-Win Solutions
Purpose: In any interpersonal conflict, you have a choice. You can look for solutions in which one person wins, usually you, and one person loses, usually the other person (win-lose solutions). Or you can look for solutions in which you and the other person both win (win-win solutions). Although, win-win solutions are obviously the more desirable, people often fail to even consider if there are possible win-win solutions and what these might be. This exercise will help you in developing conflict management skills and how to resolve interpersonal differences.
Directions: To get into the habit of looking for win-win solutions, consider the following conflict situations. For each situation, generate as many possible win-win solutions that you feel the individuals involved in the conflict could reasonably accept. Give yourself a few minutes for each case. Write down all win-win solutions that you think of; don't censor yourself. Please make sure to provide a response to the question at the end of the exercise.
1. Pat and Mark plan to take a two week vacation in August. Pat wants to go to the shore and relax by the water. Mark wants to go the mountains, hiking and camping.
2. Pat recently got a $3000 totally unexpected bonus. Pat wants to buy a new computer and printer to augment the office; Mark wants to take a much needed vacation.
3. Pat leaves clothes all around the house and they sometimes sit there for days. Mark really hates this and they argue about it almost daily.
4. Workers at the local bottling plant want a 20% raise to bring them into line with the salaries of similar workers at other plants. Management has repeatedly turned down their requests.
From this experience it should be clear that win-win solutions exist for most conflict situations but not necessarily all. And, of course, some situations will allow for the easy generation of a lot more win-win solutions than others. Not all conflicts are equal.
How might you incorporate win-win strategies into your own conflict management behavior?

Answers

Answer:

If they really want to go together, Pat and Mark could make a one-week trip to the beach, and spend the second-week hiking in the mountains. They could also choose to go on separate trips, so each can spent the entire vacation in their desired destination. Or they could go together to one of those places and agree to let the other person choose the destination in a future trip.  Given that it´s Pat´s money, She should be able to decide, and Mark can enjoy the result of whatever she chooses. Pat could accept Mark´s choice by making sure he brings something to the table, like being in charge of organizing the vacation, and make it to a place Pat really would like to go. They could also split the money and make a small trip as well as buying either the computer or the printer, but not both.  Pat could try to change her behavior and use the opportunity to ask Mark to change something she dislikes about him. Or, they could just accept that Pat is just not an organized person, find something Mark is not good at as well. Let´s say, ironing his own clothes. They could agree that each of them will take charge of what the other person won´t do. It´s difficult to find a win-win resolution to this case because workers have a legal right to assemble and fight for fair wages. Management could concede on a lower raise as long as they can offer some other perks, like providing food for their employers.

Explanation:

Personally, win-win strategies help me understand that when resolving conflicts one must consider the other side´s needs and be willing to compromise. I usually become a little stubborn when in such a situation, focusing on how I´m right and others should accept that. Trying to come with win-win solutions will probably help me get better results and keep relationships healthy.

Which of the following describes how many of the colonies responded after the Boston massacre

Answers

Answer:

if these are the answer Boston townspeople attacked and killed five British soldiers.

British soldiers attacked and killed five Boston townspeople.

British soldiers attacked Boston townspeople, who shot five soldiers dead.

Boston townspeople attacked British soldiers, who shot five colonists dead.

Explanation:

then the fourth on

The importance of environmental influences on intelligence is provided by evidence that A mental similarities between adopted children and their adoptive families increase with age. B identical twins reared together have more similar intelligence scores than fraternal twins reared together. C the average IQ scores of children are generally within one standard deviation of their parents' IQ scores. D general intelligence scores predict performance on a variety of complex tasks. E the intellectual development of neglected children in impoverished environments is often depressed. 24 of 45 2

Answers

Answer:

B identical twins reared together have more similar intelligence scores than fraternal twins reared together.

Explanation:

Apart from genetics, environment plays an important role in the the IW of a child. Some environmental factors that influence intelligence are income, availability of learning resources, nutrition, education and other factors.

With environmental factors in minds research has found out that identical twins that are raised together have similar intelligence scores compared to fraternal twins raised together

Other Questions
Most plant growth takes place in the ____________________ of the root Cows have an incredible digestive system which is highly evolved to process grass in unique ways. Please research and write a short essay regarding the function of the 4 bovine stomachs and how they all work together to process complex carbohydrates. Be sure to include the function of the reticulum, rumen, omasum, and abomasum. Given the definitions of f(c) and g(x) below, find the value of g(f(5)).f(x) = 2x 10g(x) = x2 + 6x 8 Please help me with this question The diagonals of the figure below represent the support beams for a patio covering.BE3010 yardsMAWhat is the length of each support beam?o 10 yards and 10x/3 yardsO 5 yards and 53 yardsO 10 yards and 5 yardsO 15 yards and 5 yards Need Help ASAP Thanks so much in advance... 4. Suki will soon turn 18 and wants to move into her own apartment in a few years. But she isworried that she won't be able to rent an apartment without any credit history. What can Suki doto start building a good credit hitary?a. Rent an apartment with a friend who already has signed a lease.b. Continue to use her debit card responsibly, being careful to not overdraw on the accountC. Close her checking account to avoid bouncing a check.d. Get and use a store credit card or major credit card and pay off amounts due each month. Please help if you dont mind! 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. Find the greatest common factor of 14 and 28 What was one benefit and one drawback of faster textile production using machines?Fast please 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you EnglishFlowers for Algernon question How is an IQ defined by the various characters (April 21)? which part in a mosque might be blocked 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! What is the probability that Mary will get an "11"?