I can help you:)
Most bacteria can be stained with postitevly charged stains.So this is true .My friend had a test about this so he told me all about this topic and helped me learn about it and help you.
so there you go :)
are unsaturated fats less healthy than saturated fats
SOMEONE PLZ HELP ME WITH THIS?!?!?
Table 1:
17 protons and 17 electrons
78 protons and 78 electrons
32 protons and 18 electrons
38 protons and 36 electrons
13 protons and 13 electrons
15 protons and 18 electrons
14 protons and 14 electrons
Table 2:
Ba2+ ion
Radon
Polonium
Tin
Selenium
Cesium
Magnesium Ion
IT WAS SUPER TOUGH!!!
Answer:
oh too hard
Explanation:
What are the differences and similarity between action potential and graded potential?
Help please
Answer:
Depending on the stimulus, graded potentials can be depolarizing or hyperpolarizing. Action potentials always lead to depolarization of membrane and reversal of the membrane potential. Amplitude is proportional to the strength of the stimulus. ... Duration of graded potentials may be a few milliseconds to seconds.
Explanation:
different objects in space emit wavelengths of electomagnetic radiation use the chart to match each wavelengths to correct region of the spectrum
Answer: In order of increasing frequency and decreasing wavelength these are: radio waves, microwaves, infrared radiation, visible light, ultraviolet radiation, X-rays and gamma rays.
Explanation:
Increased numbers of CAG repeats in the exon of a gene is associated with certain diseases. In a specific gene, the existing CAG codons are in the 'zero' reading frame, in- frame with the AUG initiation codon. The effect of increased numbers of CAG repeats on the encoded protein is:___________. a. to silence of the gene to generate a truncated protein b. to generate a protein with a run of consecutive glutamines c. to generate a frameshifted protein product d. none of the above
Answer:
The correct answer is - option b. to generate a protein with a run of consecutive glutamines.
Explanation:
The initiation code AUG is the code for methionine and as well as the initiation code for the particular protein or peptide chain. In this protein, there is a repeat of CAG is increased with the initiation code so, even though they are in zero reading frame they code for their amino acid which is glutamine.
So. an increased number of CAG repeats will result in a protein with the a run of consecutive glutamines.
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'
What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).
note: there are two answers for this question
Answer:
5'GATCGTAA3'
5'ATTCTAGA3'
Explanation:
As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.
Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.
DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.
Biodiversity is a measure of the:
Answer:
B.
Explanation:
Biodiversity is the diversity (variation) of biology (life). It measures the variation of life within an ecosystem. This directly correlates with B.
Explanation:
combines richness and evenness across species. it is often measured because high biodiversity is perceived a synonymous with ecosystem health
Match the age group with the recommended therapeutic consideration. Place the letter of the age group in the column labeled matching thats is appropriate for the the therapeutic consideration
Answer:
E
Explanation:
e
Compare and contrast an ecosystem driven by photosynthesis to an ecosystem driven by chemosynthesis
Answer:
Chemosynthesis gets its energy from oxidation of inorganic substance, photosynthesis gets its energy from light.
Chemosynthesis could occur just about anywhere there are enough suitable chemicals to oxidize [metabolize], while photosynthesis could occur only when there is sufficient light.
The use of solar panels has increased in the last ten years. A benefit of using solar energy would include
Answer: using less fossil fuel to meet energy needs
Explanation: i got it right
Which of these factors can help keep a freshwater resource sustainable?
O A. A growing population
O B. A new way of generating freshwater
O c. A new way of polluting water
O D. A growing demand that exceeds renewal rates
SUBT
Answer:
B.
Explanation:
A only increases the demand for freshwater, which worsens the situation.
C pollutes the water, hence making the freshwater unusable, and making it much, much more worse.
D does not change anything but make it more unsustainable.
Hope this helped!
The factors that can help keep a freshwater resource sustainable are a new way of generating freshwater, which is option B, as the growing population, a new way of polluting water, and a growing demand that exceeds renewal rates are all factors that can put a strain on freshwater resources.
What is a freshwater resource?Freshwater is a finite resource, and as the population continues to grow, the demand for freshwater increases. Climate change is also affecting freshwater availability with changes in precipitation patterns and increased evaporation rates. Therefore, it is essential to manage freshwater resources in a sustainable way to ensure that they are available for future generations.
Hence, the factors that can help keep a freshwater resource sustainable are a new way of generating freshwater, which is option B,
Learn more about the freshwater resource here.
https://brainly.com/question/29415217
#SPJ5
Which best matches objects that a scientist would include on a list describing a forest ecosystem?
Answer:
The interpretation has been outlined throughout the summary section below, as per the particular circumstance.
Explanation:
A forest or woodland habitat comprises a large field of soil that is covered by forest vegetation and inhabited by food creatures. Three major forest types occur, namely trees and shrubs plantations, mangrove swamps, as well as deciduous trees. This could be claimed that somehow natural vegetation has become an organic unit consisting of almost all of the aquatic biota, that is, have all organisms, creatures of that area that act throughout accordance because of all the resources of the atmosphere that seem to be non-living.
Recent research by Ravizza and colleagues suggests that students may spend as much as one-
typical class hour browsing the internet.
half
third
fifth
quarter
Need help on this question?
Answer:
one-half
Explanation:
According to that study done by Susan Ravizza and her colleagues students spent almost 40 minutes browsing the internet for nonacademic purposes. Since one class period is 100 minutes this would put it at almost one-half of the class period. They also found that the students used their phones for texting for around 27 minutes.
5. Bagaimanakah penggunaan plastik serai wangi ini dapat menjaga kesihatan?
Answer:
It has a lot of health benefits of fragrant lemongrass.
Explanation:
The use of this fragrant lemongrass take care of your health by preventing the growth of some bacteria and yeast. It also used to relieve the pain and swelling, reduce fever, improve sugar levels and cholesterol in the blood. It also have antioxidant properties which prevent the chances of diseases in the body. It is also used for the insects as an insect repellent, in short, fragrant lemongrass has a lot of health benefits.
PLEASE HELP me solve this!!!
Water is able to pass through the tubing.
FIRST ANSWER BRAINLYIEST
An experiment was conducted in which a purified protein from the body was exposed to a solution high in urea, and its tertiary structure was lost. When it was removed from the solution, the protein regained its original structure.
Which of the following describes what is occurring when the protein is exposed to the solution high in urea?
A. The side chains of the protein react with the urea, breaking bonds, which causes a conformation change.
B. The sequence of amino acids rearranges in a toxic environment, which causes a conformation change.
C. Urea reacts with the side chains of the protein sequence that causes a conformation change.
D. The side chains of the protein react with urea, forming new bonds that cause a conformation change.
Answer: A
Explanation: I believe its A cause it will cause the breakage of bonds.
Create an illustration showing the application of Chargaff’s rule in the structure of DNA.
What do you think is going to happen to this country's population over the next 20 years?
Answer:
The second answer
Explanation:
Which fossil fuel is made when plants from swamps are covered, pressed and heated for millions of
years?
A Coal
B Petroleum
C Natural Gas
D Nuclear
Answer:
petroleum i think , i may b wrong
Answer: A Coal
Explanation:
3.The two phases of photosynthesis are _____ reactions and _____ reactions._____. DOC 1
a.)glucose-dependent
B)glucose-independent
C.)light-independent
d.)light-dependent
Answer:
c
Explanation:
needed for
photosynthesis
When a person pulls a wagon, the person puts a force on the wagon that makes it move.
The force of a person pulling a wagon is an example of?
Along with water conservation animals also have unique characteristics for
Answer:
They may be soggy and stinky, but they provide critical habitat for tons of plants and animals, help clean our water, control floods, and provide food for humans.
this is the question
Answer:
no
Explanation:
Answer:
see on the comment
Explanation:
sorry see on the previous comment I am in hurry sorry
Where did all of the material come from that makes up the trees?
Answer:
Explanation:
The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water.
Birds belong to different species but share similar characteristics. What inference can be correctly drawn about this statement? (5 points)
Group of answer choices
All birds share the same habitat.
All birds produced similar offspring.
All birds reproduce with genetic variation.
All bird species adapt through evolution
Answer:
All bird species adapt through evolution
Explanation:
The correct answer would be that all birds reproduce with genetic variation and adapt through evolution.
Sexual reproduction causes genetic variation in sexually reproducing organisms due to crossing over and a random assortment of genes. Birds can only reproduce sexually and hence. they produce offspring that are genetically different but that might share many similar characteristics.
Evolution refers to the development of complex organisms from simple ancestral ones. Organisms change and evolve as they constantly try to adapt to their changing environments. Hence, organisms of the same species growing in a different environment might end up becoming different species as a result of adapting to their different environments, although they would still have some similarities to one another. In other words, evolution has a tendency to cause speciation.
possible question and essays for gr 12 Life Scences
Answer:
Explanation:
Possible Essays for Life Science:
1. "Explain four management strategies to improve the quality of drinking water. Uncle Two sources of water pollution and Two effect of water pollution on human health. "
2. "Eutrophication is one of most important water quality problem South Africa. Describe Eutrophication, what causes it and how it affects water quality."
3. "Describe the significance of DNA replication and meiosis and how the foetus is protected and nourished in the uterus."
4. "Describe how meiosis contribute to genetic variation and how
abnormal meiosis leaf to down syndrome and polyploidy. Also
describe advantages of polyploidy in agriculture. "
Question 2 (1 point)
The theory that all of the continents were once in one location in the form of a
"supercontinent" is called...
Pygmalion
Patagonia
Pangea
Ponderosa
Answer:
Pangaea
Explanation:
continental drift
Alfred Wegener proposed that the continents were once united into a single supercontinent named Pangaea, meaning all earth in ancient Greek. He suggested that Pangaea broke up long ago and that the continents then moved to their current positions. He called his hypothesis continental drift.
Answer:
I think it's the 3 one
Explanation:
(NOW PLSSS I’LL GIVE BRAINLIEST) Ally sees a photograph of a macaroni penguin that lives in South Georgia, a sub-Antarctic island. She reads more about these penguins
and learns that they mate for life. She knows that not all animals mate for life and that there are various combinations of mating systems,
Describe two mating systems, and explain why different systems exist.
Answer:
It depends on their life expectancy. There is an bird that is born and dies on the same day (sorry I cannot remember the name) so as soon as they can mate, they mate until death. Not every animal mate for life because they live longer. Animals that mate for life mate because they have a short life so they do this to continue the population.
Glycolysis joins glucose to other molecules to make pyruvate. True or false
Answer:
false
Explanation:
The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.
Glycolysis is the first stage or process of cellular respiration in which -
one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysisC₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺ → 2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺
On the basis of the given explanation, it is evident that the given statement is a false statement.
Learn more about glycolysis:
https://brainly.com/question/10886602
In guinea pigs, short hair is dominant over long hair. If a short haired DD guinea pig is crossed with a long haired dd guinea pig, what are the possible genotypes and phenotypes of their offspring and the percent chance of each?
Answer:
All are Heterozygous dominant pigs in F1 generation &
In F2 generation 1:2:1 is genotype & 3:1 is phenotype