If the base area of a cylinder is 176.625
square centimeters and the height is 3.5
centimeters, determine the volume of the
cylinder

Answers

Answer 1

Answer:

618.1875 cm^3

Step-by-step explanation:

Volume = base area x height, so 176.625 x 3.5 = 618.1875


Related Questions

Which expressions simplify to 4? Select all that apply.

Answers

Answer:

B and D

Step-by-step explanation:

As inflation increases, it causes the money you earn today to have _____. less value in the future more purchasing power in the future no purchasing power effect in the future more value in the future

Answers

Answer:

This answer is A

Step-by-step explanation:

your welcome, im fast to answer

Answer:

the answer is a

Step-by-step explanation:

What is the median of the data set?

73, 20, 63, 23, 20, 40, 67

Answers

Answer:

40

Step-by-step explanation:

if you line the numbers up like so you will see the number in the middle is 40

aka the median

20,20,23,40,63,67,73

A cook makes vegetable barley soup by mixing 2 pounds of barley into 7 quarts of vegetable broth. Assume that the cook continues to use the same rate to make more batches of soup. How many pounds of barley should the cook mix with 35 quarts of broth?

Answers

Answer: The answer to this question is 10 :D

Step-by-step explanation:

The answer is 10 pounds.

2 pounds            7 quarts

4                                14

6                                 21

8                                 28

10                                35

HELP!!! Name the space figure you can form from the net.

Answers

I believe it is a triangular prism

For the equation, complete the given ordered pairs.

3x-y=4

{0,_} [1,_} {_,4}


Can someone help me

Answers

Answer:

{0,-4} [1,-1} {8/3,4}

Step-by-step explanation:

3x - y = 4

{0,_} [1,_} {_,4}

For x = 0:

3x - y = 4

0 - y = 4

y = -4

For x = 1

3x - y = 4

3 - 3 - y = 4 - 3

-y = 1

y = -1

For y=4

3x - y = 4

3x -4 = 4

3x = 8

x = 8/3

Solution:

{0,-4} [1,-1} {8/3,4}

Please mark brainliest if this helped!

Please mark brainliest if this helped!

Here is the equation help

Answers

Answer: this might help I’m not sure

Step-by-step explanation:

Answer:

5m+3m=8m

simplified

Step-by-step explanation:

combine all m's together 5m's +3m's =8m's

(☆▽☆)

The graph shows the distance traveled by an Olympic-level sprinter over time during a race.
Find the slope of the line, and complete the sentences below.

100 meter race graph of a diagonal line on a coordinate plane going up and to the right with Time in seconds on the x axis and Distance in meters on the y axis. The line begins at the origin and passes through the point 2 comma 20.

Answers

9514 1404 393

Answer:

slope: 10 m/srepresents speed in meters per second

Step-by-step explanation:

The slope is the change in the quantity on the vertical scale, divided by the corresponding change in the quantity on the horizontal scale.

Here, the line goes from 0 to 100 meters on the vertical scale, corresponding to a change from 0 to 10 seconds on the horizontal scale. So, the slope is ...

  m = (100 m)/(10 s) = 10 m/s . . . . slope of the line

The ratio of distance to time is given the name "speed", so ...

  the slope represents the sprinter's speed in meters per second.

Hey i need help with this

Answers

Answer:

The x-intercepts are 1 and 3

The y-intercept is 3

The vertex is (2,-1)

The line of symmetry is x=2

Step-by-step explanation:

To find the x-intercepts, find where the graph intersects the x-axis, or the horizontal line. To find the y-intercept, find where the graph intersects the y-axis, or the vertical line. To find the vertex, find the coordinate where the graph is at its lowest point (or highest if it is flipped upside down). To find the line of symmetry, simple use the x-coordinate of the vertex and say x= (the x-coordinate)

PLEASE HELPP ASAPPP will mark brainlist

Answers

Answer:

I think this is the answer for the second question.

Calculate the volume of a cuboid with length 5.6m breadth 4.1m, height 3.4m

Answers

Answer:  78.064 cubic meter

Step-by-step explanation:

volume of a cuboid=length × breadth × height.

                                =5.6*4.1*3.4

                                =78.064 cubic meter

Can someone please do my math work I am gonna lose my permit soon and my mom just passed and I'm struggling

Answers

My bro just go up to ur mom and moan VERY loud and sh will b all lik ok ok u don’t worry about math

If A(x1, y1), B(x2, y2), (X3, Y3), and D(xx,ya) form two line segments, AB and CD, which condition needs to be met to prove AB ICD? ОА У4 -У, У, -у, - X4 - X X - X OB. 74-Y3 + X4-X = 0 V₂ - X, X - X, oc Yo-Yay 72-Y1--1 x - x x - X, OD. 12-y, *- X, = 1 x₂ - X, Yo-Y OE Y:-72. X.-X2-0 Y₂-X, X - X, ​

Answers

Answer:

The answer is option C..........

To prove that AB is parallel to CD, we need to show that the slope of AB is equal to the slope of CD.

What is line segment?

A line segment is a section of a line with two endpoints. A line segment, unlike a line, has a fixed length.

To demonstrate that AB is parallel to CD, we must show that the slope of AB equals the slope of CD.

The slope of AB can be calculated using the formula:

mAB = (y2 - y1) / (x2 - x1)

Similarly, the slope of CD can be calculated using the formula:

mCD = (ya - Y3) / (xx - X3)

If mAB = mCD, then AB is parallel to CD.

Therefore, the condition that needs to be met to prove AB is parallel to CD is: (y2 - y1) / (x2 - x1) = (ya - Y3) / (xx - X3)

For more details regarding line segment, visit:

https://brainly.com/question/30072605

#SPJ7

Select the correct graph.

Which graph represents function f?

Answers

Answer: top right graph

Step-by-step explanation: Put in calculator and you will find the answer

Help if you can :)
Also, show work!

Plz dont add any type of link

thxx <3

Answers

there is no question

A cylinder and a cone have the same volume. The cylinder has a radius of 2 inches and a height of 3 inches. The cone has a radius of 3 inches. Determine the height

Answers

Answer:

so lets get the cones volume first the formula for a cone is V=πr2/3

so V=πr2h

3=π·22·3

3≈12.56637

and then the height of the cylinder is 4

Step-by-step explanation:

Help me please! I will mark brainliest for whoever gets it right the fastest.

Answers

Answer:

300

Step-by-step explanation:

surface area of prism = p (perimeter)*height + 2* base area

sa = (12+13+5) * 8 + 2* (12*5/2)

    = 30*8 + 2*30

    = 240+60

    = 300

find the value of x

please

Answers

Answer:

x = 51

Step-by-step explanation:

These angles equal each other because they're vertical angles so:

2x + 8 = 110

2x = 110 - 8

2x = 102

x = 51

To reach her summer reading goal, Elisa has to read at least 30 books. The inequality b ≥ 30 represents the number of books she needs to read. Which of the following is the solution to this inequality?

Answers

Answer:

hii

have a good day for you!

A sequence can be generated by using an=12an−1, where n is a whole number greater than or equal to 1.

Given a9=12, what is a10?

5
6
13
24

Answers

Answer:

8, 11, 14, 17

Step-by-step explanation:

For example,

Given: an=2an−1−xan=2an−1−x

a5=99a5=99

a3=27a3=27

a5=2a4−x=2(2a3−x)−x=4a3−3x=99a5=2a4−x=2(2a3−x)−x=4a3−3x=99

4(27)−3x=994(27)−3x=993x=108−99=93x=108−99=9

x=3x=3

According to the scatter plot shown, what approximate income should a 24-year old have?
Income
45,000
40.000
35,000
30,000
25.000
20,000
15,000
10,000
5,000
O
16 18 20 22 24 26 28 30 32
Age
$35,000
$25,000
$20,000
$30,000

Answers

Answer:

25,000

Step-by-step explanation:

What is the volume of this rectangular prism? 1/2cm 4cm 3/2cm
i will mark brainliest thank u​

Answers

Answer:

3

Step-by-step explanation:

i changed 1/2 into 0.5 and 3/2 into 1.5 then 0.5 times 4 times 1.5 and got 3

pls mark me branilest

Which expression is equivalent to 64^1/4

Answers

Answer:

C

Step-by-step explanation:

It is C because 64 to 1/4 power is just 64 divided by 4.

• Simon's secret coffee recipe uses 4 sugar
cubes for every 12 cups of coffee he
makes. Last week he made 192 cups of
coffee. How many sugar cubes did he use
last week?

Answers

So we divided 12 and 4 and that makes 3 and then 3x192=576

A die with 8 sides is rolled. What is the probability of rolling a number less than 3

Answers

Answer: 6/8

simplify by 2 and you get 3/4 your answer is 3/4

Step-by-step explanation:

the spinner is divided into 12 equal sectors. What is the possibility of not spinning a 2?

Answers

Answer:

11/12

Step-by-step explanation:

I am assuming the spinner is divided into 12 equal sectors and numbers 1-12 are written on them. Comment if I am wrong.

Spinning the 12 sided spinner, there is a 1/12 chance of spinning a specific number. So we take the opposite of that, which is 11/12. The chances of not rolling a two mean it comes out true if you roll numbers 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

Find the measure of 26.
4 6 = [?]
249
46

Answers

Answer:

Solution given:

<6+24=180[co- interior angle]

<6=180-24=156°

<6=156°

76 is what percent of 475?

Answers

Answer:

361

475*76%=361

Hope this helped you out!!

Answer:

16

Percentage Calculator: 76 is what percent of 475? = 16.

Step-by-step explanation:

Answered by none other than the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

Hope this helped!!


Out of 140 students, 92 are taking an English course, 74 are taking a history course and 41 are taking both. Find the number of these 140 students who are taking a history course but not an English course?

Answers

Answer:18

Step-by-step explanation:

Answer:

33

Step-by-step explanation:

you have to subtract the number of people doing both from the number of people doing just the history.


You volunteer to help drive children at a charity event to the zoo, but you can fit only 7 of the 19 children present in your van. How many different groups of 7 children
can you drive?
How many different groups of 7 children can you drive?

Answers

Answer:

3

Step-by-step explanation:

Other Questions
What's the correct hair color terminology hair color companies use forgreen, orange, and yellow base's? 16 cars are parked if 1/4 of them are blue how many cars are blue What is the moral of the story of the chapter/essay 'Primary Lessons' in Silent Dancing by Judith Ortiz sketch the electrolytic cell for converting alumina to aluminum A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which expressions simplify to 4? Select all that apply. Help meeeeeeeeB) Write the name of the food that does not belong to the same category and explain why.Ex. tarta- helado-pimienta-manzana. La pimienta. No es dulce.1. refresco/agua/leche/carne/. _______________________. _________________________2. banana/manzana/pescado/naranja/.________________. ________________________3. fruta/helado/torta/pescado/. ________________________. ________________________4. pollo/ pescado/carne/refresco/. _______________________. ______________________5. pastel/ leche/ jugo de naranja/t/______________________. _______________________ How many molecules of methane gas (CH4) are in 32.1 grams of methane i need help with that please . Why does a mountain create a rain shadow on the other side of a mountain? Calculate the volume of a cuboid with length 5.6m breadth 4.1m, height 3.4m What is the mean of the set of data? 18, 11, 16, 8, 16, 21 plz help If you were a jedi during order 66 were would you hide? Help plz due now will mark brainliest if correct Why does dally like to fight Use variables to write an equation that represents the relationship between the time x and the distance y . A person runs 175 yards per minute.An equation that represents the relationship is y=______ PLEASE HELP ILL MARK BRAINLIEST Which of these statements is NOT true about African Americans beforethe Civil War? *A. Free Blacks in the North enjoyed many freedoms but not equalityB. Very few African-Americans in the South were free.C. Most African-Americans in the North were free.D. Most African-Americans in the South were free. HELP!!! Name the space figure you can form from the net. Three Methods for Choosing JudgesAt the federal level, judges are nominated by the President and then those nominees have to be approved by the Senate. The U.S. Constitution does not specify how states can choose their judges so different states use different methods. The three most common methods used by states are listed below:Method 1: Direct elections - Candidates raise money and campaign to be a judge. The voters then elect one of the candidates.Method 2: Appointment - In this method, state judges are appointed by the Governor. There is often no legislative approval required. A couple of states have the state legislature appoint judges, but usually it is the Governor.Method 3: The Missouri Plan - This is a compromise between methods 1 and 2. In the Missouri Plan, the governor appoints judges, but the governor must make each appointment from a list of three candidates recommended by a judicial nominating commission. The commission is made up of a sitting judge, several legal experts, and some private citizens. Each judge named by the governor serves until the next election. The judge's name then appears on the ballot without opposition. The voters decide, in a yes-no vote, whether or not that judge should be kept in office. Should the voters reject a sitting judge, the process begins again.Read the information above about the three methods most commonly used to select judges at the state level. Pick the method that you believe is the best. Write a paragraph persuading your fellow Ohioans that Ohio should start using this method. If you agree with how Ohio already chooses its judges, then persuade a different state to use our current method. Your essay needs to provide three (3) arguments supporting your method of choice, and you need to back these arguments up with supporting details. For example, you could use constitutional principles to back up your arguments.plz help Ultraviolet light from the Sun can