If a cell suddenly stopped producing transfer RNA, which of the following processes would be immediately affected?

Answers

Answer 1

Answer: DNA

Explanation: The RNA is a big affect on the DNA because, there will be no repairs of the DNA leading to cancer


Related Questions

The diagram shows four pairs of chromosomes from the karyotype of a normal human male.
Select the pair of sex chromosomes.

Answers

Answer:

According to the karyotype image, the sex chromosomes of a normal human male are those of the last picture, where both are different.

Explanation:

The sex chromosomes are those that determine the sex in a species, as in the human being and other species X and Y. XY chromosomes determine the male sex while the XX sex pair corresponds to the female sex.

In humans, the chromosomes are grouped by pairs with the same characteristics, that is, most pairs of chromosomes are identical. The only exception is represented by the male human sex chromosomes X and Y. This difference in the sex chromosomes causes the different sex chromosomes (picture) to be called heterogametic.

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

What is the difference between a molecule and a diagram of a molecule ?

Answers

Answer: The molecule itself is the actual thing present.

while the diagram explains what makes up a molecule or what it looks like structurally

Explanation:

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

Jimmy and Marquis are conducting an experiment in class. They have
planted four seeds in four different pots. They placed the pots in different
places around the classroom: in a sunny window, on the work table, on the
floor near the window, and under the boys' desk. The boys watered the
pots every morning when they arrived at school. Once the seeds sprouted
the boys measured how much each seed grew. "Wowl" said Marquis, after
3 weeks of observing and measuring, "I can tell which seed was under our
desk!" Can you? Which seed was placed under the boys desk?
Measuring Plant Height
10
Plant Height (Inches)
Seed 1 Seed 2 Seed 3 Seed 4

Answers

The plant with the lowest height would be the one to have grown under the desk.

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

How does biology affect behavior?

Answers

Answer:

some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.

Explanation:

There you go

Biology is a normal thing it diesnt really effect us

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

I WILL GIVE BRAINLIEST
Use the image to answer the question.

The image shows a food chain. An arrow points from grass to a grasshopper. An arrow points from the grasshopper to a lizard. An arrow points from the lizard to a hawk. An arrow points from the hawk to a fox.

What would happen if the number of grasshoppers in this food chain decreased?

A.
The amount of grass would increase.

B.
The number of lizards would increase.

C.
The amount of grass would decrease.

D.
The number of hawks would increase.

Answers

Answer:

a, the amount of grass would increase

Explanation:

if the grasshopper is the one in this diagram eating the grass, and suddenly there were fewer grasshoppers to do that, the grass would increase because more of it can grow without being eaten

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone​

Answers

Answer:

1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes

Explanation:

The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

Other Questions
What allowed homosapiens to migrate further than earlier people? correct order of events during the process of nucleosynthesis? of 7A son was born when his father was 28 years old. If the sum of their ages in2060 B.S. was 44 year, find their ages in 2070 B.S.TC. Plz help and I will give brainliest A family wants to save $100 each month. They record their progress toward this goal at the end of each month. In January they saved $120 and recorded 1$20 at the end of the month. What should they record for the month of February if they only saved $80 that month? Explain.If you put anything random as the answer I WILL report Complete the sentence about the crystallization of magma.The rate at which magma determines theof the crystals in the new rock. A cone has a diameter labeled twelve centimeters and a height labeled thirty-two centimeters. Find the area of a vertical cross section through the center of the base of the cone. Surely she was near the cabins now, Sam thought. Even as she saw thestorm clouds headed her way, she hiked on up the mountain. Shecould set up her tent here, she knew, and wait out the approachingstorm. It was getting closer, and it would be so much easier to set upthe tent now while the weather was still dry. But it would be so muchmore comfortable if she could just get to the cabin first. More thananything, she just wanted to sleep in a real bed tonight. As the firstdrops of rain began to fall, Sam stopped. She struggled to set up thetent as the wind whipped around her. Look at the Attachments! Thanks! explain the "don't rule" in training What process move sound waves to the oval window? What is the function of the oval window? One mole of a substance has a different number of particles as one mole of another substance.O TrueO False A game has purple and orange pieces. The ratio of purple game pieces to total pieces is 7:16. Select all the statements about the game pieces that are correct.A. The ratio of purple pieces to orange pieces is 9:7.B. The ratio of total pieces to orange pieces is 16:9.C. The ratio of total pieces to purple pieces is 16:9.D. There must be 9 more orange pieces than purple pieces. 1. What is the approximate world population? There are 7.674 billion people on earth.2. What is the approximate world refugee population? 3.6 million3. What percent of the world population consists of refugees? Round your answer to the nearest tenth. 4. Roughly 3.5 billion people have wealth of less than US $10,000. What percentage of the global population does this represent? Round your answer to the nearest hundredth.5. Approximately 50% of all refugees are children (under the age of 18). How many refugees are children? Round your answer to the nearest whole number. A board game uses a bag of 105 lettered tiles. You randomly choose a tile and return it to the bag. The table shows the number of vowels and the number of consonants after 50 draws. Predict the number of vowels in the bag. This is what the table says: Vowels Consonants 18 32 Which table represents the statement a draft friends at a rate of 32 mph A paragraph is a group of s________________________ related to one topic. PLEASE HELP!!! :(I WILL MARK BRAINLIEST13 POINTSWhich revision corrects the inappropriate shift in verb mood?You should get new clothes. And get a haircut.A. You should get new clothes. And you should get a haircut.B. You should get new clothes. Get a haircutC. Get new clothes. And you should get a haircutD. You should get new clothes and get a haircut Do the ratios 64 and 76 form a proportion?YES OR NO? PLZ HELP ME Which of the following provisions was usually supported by Socialists?A.the creation of more large, corporate-owned farmsB.the expansion of Americas largest banks and corporationsC.the unionization of workers in the nations factoriesD.the creation of more laws mandating segregation in American society What is c? 1/3c = 3/8;c=3/4