If 710-nm and 655-nm light passes through two slits 0.65 mm apart, how far apart are the second-order fringes for these two wavelengths on a screen 1.1 m away?

Answers

Answer 1

Answer:

Explanation:

Position of n the order fringe = n λ D / d

for n = 2

position = 2 λ D / d

λ = 710 nm , D = 1.1 m

d = .65 x 10⁻³

position 1 = 2 x 710 x 10⁻⁹ x 1.1 / .65 x 10⁻³

= 2403.07 x 10⁻⁶ m

= 2.403 x 10⁻³ m

= 2.403 mm .

For λ = 655 nm

position = 2 λ D / d

λ = 655 nm , D = 1.1 m

d = .65 x 10⁻³

position 2 = 2 x 655 x 10⁻⁹ x 1.1 / .65 x 10⁻³

= 2216.91 x 10⁻⁶ m

= 2.217 x 10⁻³ m

= 2.217 mm .

Difference between their position

= 2.403 - 2.217 = .186 mm .


Related Questions

A 1430 kg is moving at 25.6 m/s when a force is applied, in the direction of the cars motion. The car speeds up to 31.3 m/s. If the force is applied for 5.4 s what is the magnitude of the force

Answers

The car accelerates with magnitude a such that

31.3 m/s = 25.6 m/s + a (5.4 s)

→   a = (31.3 m/s - 25.6 m/s) / (5.4 s) ≈ 1.056 m/s²

Then the applied force has a magnitude F of

F = (1430 kg) a1500 N

How much heat is absorbed by 3 kg honey baked ham as energy from the oven causes its temperature to change from 10°C to 60°C? (Specific heat capacity of ham 3287 cal/kgºC)?

Answers

Answer:

The answer is 493.05kJ

Explanation:

given

mass m= 3kg

t1=  10°C

t2= 60°C

Specific heat capacity of ham =3287 cal/kgºC

Required,

The quantity of heat, Q

Step two:

the formula is

Q= mcΔT

substitute

Q= 3*3287(60-10)

Q=9861*50

Q=493050 J

Q= 493.05kJ

A certain heat engine does 30.2 kJ of work and dissipates 9.14 kJ of waste heat in a cyclical process.
A) What was the heat input to this engine?
B) What was its efficiency?

Answers

Answer:

a) [tex]H_{in}=39.34 kJ[/tex]

b) Efficiency=76.77%

Explanation:

a)

In order to solve this problem, we can use the following formula:

[tex]H_{in}=H_{out}+W[/tex]

the problem provides us with all the necessary information so we can directly use the formula:

[tex]H_{in}=9.14kJ+30.2kJ[/tex]

[tex]H_{in}=39.34 kJ[/tex]

b) In order to find the efficiency, we can use the following formula:

[tex]Efficiency=\frac{W}{H_{in}}*100\%[/tex]

so we get:

[tex]Efficiency=\frac{30.2kJ}{39.34kJ}*100\%[/tex]

Efficiency=76.77%

Two cylinders each with a 60 cm diameter, thatare closed at one end, open at the other, are joined to form asingle cylinder, then the air inside is removed.
How much force does the atmosphere exert onthe flat end of each cylinder?
Suppose one cylinder is bolted to a sturdy ceiling. How many 90 kg football players would need to hang from the lower cylinder to pull the two cylinders apart

Answers

Answer:

a

The force is  [tex]F = 2864561.4 \ N[/tex]

b

The number is [tex]N = 3248 \ players[/tex]

Explanation:

From the question we are told that

    The  of each cylinder is  [tex]d = 60 \ cm = 6 \ m[/tex]

     The mass of the players is  [tex]m = 90 \ kg[/tex]

Generally the cross-sectional  area of the cylinder is mathematically represented as

     [tex]A = \pi * \frac{d^2}{4}[/tex]

=>  [tex]A = 28.3 \ m^2[/tex]

Generally force exerted on the flat end of each cylinder is mathematically represented as

      [tex]F = A * P[/tex]

Here P  is the atmospheric pressure with value  [tex]P = 101300 \ Pa[/tex]

So

       [tex]F = 28.3 * 101300[/tex]

=>    [tex]F = 2864561.4 \ N[/tex]

Generally the weight of a single football player is  

        [tex]W = m * g[/tex]

=>     [tex]W = 90 * 9.8[/tex]

=>     [tex]W = 882\ N[/tex]

Generally the number of player required to pull the two cylinders apart is mathematically represented as

       [tex]N = \frac{ F }{W}[/tex]

=>     [tex]N = \frac{ 2864561.4 }{882}[/tex]

=>     [tex]N = 3248 \ players[/tex]

Compute the specific heat capacity at constant volume of nitrogen (N2) gas. The molar mass of N2 is 28.0 g/mol.

Answers

Answer:

724.3J/Kg.K

Explanation:

CHECK THE COMPLETE QUESTION BELOW

Compute the specific heat capacity at constant volume of nitrogen (N2) gas.and compare with specific heat of liquid water. The molar mass of N2 is 28.0 g/mol.

The specific heat capacity can be computed by using expression below

c= CV/M

Where c= specific heat capacity

M= molar mass

CV= molar hear capacity

Nitrogen is a diatomic element, the Cv can be related to gas constant with 5/2R

Where R= 8.314J/mol.k

Molar mass= 28 ×10^-3Kg/mol

If we substitute to the expression, we have

c= (5R/2)/(M)

=5R/2 × 1/M

=(5×8.314) /(2×28 ×10^-3)

=724.3J/Kg.K

Hence, the specific heat capacity at constant volume of nitrogen (N2) gas is

724.3J/Kg.K

The specific heat of liquid water is about 4182 J/(K kg) which is among substance with high specific heat, therefore specific heat of Nitrogen gas is 724.3J/Kg.K which is low compare to that of liquid water.

A 30 N force toward the west is applied to an object. The object moves 50 m east during the time the force is applied. What is the change in kinetic energy of the object?
a) 1.0 J
b) 750 J
c) 1.7 J
d) -1500 J

Answers

Answer:

D.-1500Joules

Explanation:

The change in kinetic energy of the object s equivalent to the workdone by the body in the west direction (negative x direction)

Workdone = Force * Distance

Given

Force = 30N

Distance moved by the object = 30m

Required

Kinetic energy

Kinetic energy = 30 * 50

Kinetic energy = 1500Joules

Since the body moves in the negative  direction, hence the kinetic energy will be -1500Joules

How can you prove that the potential energy of a stretched spring turns into kinetic energy when you release the spring?

Answers

Potential energy+Kinetic energy=Total energy

When you release a spring the velocity increases, therefore the kinetic energy increases ke=1/2*mv^2 and the displacement decreases therefore the potential energy decreases pe=1/2*kx^2.

Help ASAP plz and thx u

Answers

Answer:

a). a = F/m

Explanation:

Formula is F=ma

the answer is a ) a=F/m

Which of the following is true?
A
The Atlantic, Pacific, Indian, Arctic, and Southern Oceans are completely separate
from each other.
B
The ocean covers about half of the Earth's surface.
с
Scientists have studied most of the ocean, but a tiny bit remains unexplored.
D
Scientists know more about the moon than they do the ocean.

Answers

I think that d is true but I’m not for sure

Answer:

options B,C,D are true

Explanation:

Answer this question: Is math really important to giving science power? (remember the 5 Ws and the H)

Answers

i don’t really understand what you are asking but i believe that math is important to giving science power without math it’s wouldn’t really be a thing yk but i don’t i understood what’s your asking ?

Which scenario is an example of the transfer of thermal energy by radiation?

A. Water boils in a pan.

B. Hot air circulates in an oven.

C. An ice cube melts in a person's hand.

D. A frozen lake melts under the Sun.

Correct answer is D

Answers

Answer:

its D: A frozen lake melts under the sun.

Explanation:

Radiation is the transfer of heat energy through space by electromagnetic radiation. Most of the electromagnetic radiation that comes to the earth from the sun is invisible. Only a small portion comes as visible light. Light is made of waves of different frequencies.

d i hope this helps the person above me told you the right answer!!

If a body having mass 40kg started moving initially with rest and it takes a velocity of 20m/sec in time 4 seconds. Find the value of force​

Answers

[tex]{\mathfrak{\underline{\purple{\:\:\: Given:-\:\:\:}}}} \\ \\[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Mass \ of \ the \ body \ (m) = 40 \ kg}[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Final \ velocity \ of \ the \ body \ (v) = 20 \ m/s}[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Initial \ velocity \ of \ the \ body \ (u) = 0}[/tex]

[tex]\\[/tex]

[tex]{\mathfrak{\underline{\purple{\:\:\:To \:Find:-\:\:\:}}}} \\ \\[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Force \ exerted \ by \ the \ body \ ( F)}[/tex]

[tex]\\[/tex]

[tex]{\mathfrak{\underline{\purple{\:\:\: Solution:-\:\:\:}}}} \\ \\[/tex]

Using 1st equation of motion

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{v = u + at}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{20 = 0 + a(4)}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{20 = 4a}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{\dfrac{\cancel{20}}{\cancel{4}} = a}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{a = 5}[/tex]

[tex]\\[/tex]

Now, Finding the force exerted

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = ma}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = 40 \times 5}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = 200 \ N}[/tex]

[tex]\\[/tex]

Hence, [tex]\\[/tex]

[tex]\:\:\:\:\star\:\:\:\sf{The \ force \ exerted \ by \ the \ body \ is \ 200N}[/tex]

what is the lowest possible tempature

Answers

Absolute zero, technically known as zero kelvins, equals −273.15 degrees Celsius, or -459.67 Fahrenheit, and marks the spot on the thermometer where a system reaches its lowest possible energy, or thermal motion.

The mass and coordinates of three objects are given below: m1 = 6.0 kg at (0.0, 0.0) m, m2 = 1.5 kg at (0.0, 4.1) m, and m3 = 4.0 kg at (1.9, 0.0) m. Determine where we should place a fourth object with a mass m4 = 7.9 kg so that the center of gravity of the four-object arrangement will be at (0.0, 0.0) m

Answers

Answer:

The location of the center of gravity of the fourth mass is [tex]\vec r_{4} = (-0.961\,m,-0.779\,m)[/tex].

Explanation:

Vectorially speaking, the center of gravity with respect to origin ([tex]\vec r_{cg}[/tex]), measured in meters, is defined by the following formula:

[tex]\vec r_{cg} = \frac{m_{1}\cdot \vec r_{1}+m_{2}\cdot \vec r_{2}+m_{3}\cdot \vec r_{3}+m_{4}\cdot \vec r_{4}}{m_{1}+m_{2}+m_{3}+m_{4}}[/tex] (1)

Where:

[tex]m_{1}[/tex], [tex]m_{2}[/tex], [tex]m_{3}[/tex], [tex]m_{4}[/tex] - Masses of the objects, measured in kilograms.

[tex]\vec r_{1}[/tex], [tex]\vec r_{2}[/tex], [tex]\vec r_{3}[/tex], [tex]\vec r_{4}[/tex] - Location of the center of mass of each object with respect to origin, measured in meters.

If we know that [tex]\vec r_{cg} = (0,0)\,[m][/tex], [tex]\vec r_{1} = (0,0)\,[m][/tex], [tex]\vec r_{2} = (0, 4.1)\,[m][/tex], [tex]\vec r_{3} = (1.9,0.0)\,[m][/tex], [tex]m_{1} = 6\,kg[/tex], [tex]m_{2} = 1.5\,kg[/tex], [tex]m_{3} = 4\,kg[/tex] and [tex]m_{4} = 7.9\,kg[/tex], then the equation is reduced into this:

[tex](0,0) = \frac{(6\,kg)\cdot (0,0)\,[m]+(1.5\,kg)\cdot (0,4.1)\,[m]+(4.0\,kg)\cdot (1.9,0)\,[m]+(7.9\,kg)\cdot \vec r_{4}}{6\,kg+1.5\,kg+4\,kg+7.9\,kg}[/tex]

[tex](6\,kg)\cdot (0,0)\,[m]+(1.5\,kg)\cdot (0,4.1)\,[m]+(4\,kg)\cdot (1.9,0)\,[m]+(7.9\,kg)\cdot \vec r_{4} = (0,0)\,[kg\cdot m][/tex]

[tex](7.9\,kg)\cdot \vec r_{4} = -(6\,kg)\cdot (0,0)\,[m]-(1.5\,kg)\cdot (0,4.1)\,[m]-(4\,kg)\cdot (1.9,0)\,[m][/tex]

[tex]\vec r_{4} = -0.759\cdot (0,0)\,[m]-0.190\cdot (0,4.1)\,[m]-0.506\cdot (1.9,0)\,[m][/tex]

[tex]\vec r_{4} = (0, 0)\,[m] -(0, 0.779)\,[m]-(0.961,0)\,[m][/tex]

[tex]\vec r_{4} = (-0.961\,m,-0.779\,m)[/tex]

The location of the center of gravity of the fourth mass is [tex]\vec r_{4} = (-0.961\,m,-0.779\,m)[/tex].

What is the Basic SI unit for distance/length

A. Meters
B. Liters
C. Grams
D. Millimeters

Answers

Meters because distance measures in meters
Meters because distance measure is meters and remeber distancextime measure In meters

Professional baseball pitchers deliver pitches that can reach the blazing speed of 100 mph (miles per hour). A local team has drafted an up-and-coming, left-handed pitcher who can consistently pitch at 42.24 m/s (94.50 mph).
A. Assuming a pitched ball has a mass of 0.1420 kg and has this speed just before a batter makes contact with it, how much kinetic energy does the ball have?
B. How high would the ball need to be dropped from to attain the same energy (neglect air resistance)?

Answers

Answer:

A. ) K =126. 7 J

B. ) h= 91.1 m.

Explanation:

A)

Assuming no air resistance, once released by the pitcher, the speed must keep constant through all the trajectory, so the kinetic energy of the ball can be expressed as follows:

       [tex]K = \frac{1}{2}*m*v^{2} = \frac{1}{2}*0.142 kg*(42.24m/s)^{2} = 126.7 J (1)[/tex]

B)

Neglecting air resistance, total mechanical energy must be the same at any point, so, if we choose the ground level as the zero reference level for the gravitational potential energy, and assuming that the ball attains this kinetic energy just before striking ground, this value must be equal to the gravitational potential energy just before be dropped, so we can write the following equality:

        [tex]U_{o} = K_{f} = 126. 7 J (2)[/tex]

        ⇒ m*g*h = 126. 7 J

Solving for h, we get:

       [tex]h = \frac{K_{f}}{m*g} = \frac{126.7J}{0.1420kg*9.8m/s2} = 91.1 m (3)[/tex]

in the case shown below, the 1 kg rock rides on a horizontal disk that rotates at constant speed 5m/s about its vertical axis. the radius of the disk is 1 meter. What is the magnitude of the friction?

Answers

Answer:

25

Explanation:

____ is the ability to course change in matter

Answers

Answer:

i don't know the correct answer

but this is what i found on web

Explanation:

Changes of state are physical changes in matter. They are reversible changes that do not change matter's chemical makeup or chemical properties. Processes involved in changes of state include melting, freezing, sublimation, deposition, condensation, and evaporation. Energy is always involved in changes of state.

Gregor Mendel observed that pea plant traits did not blend in their offspring?

Answers

Pea plants traits do not blend with their offsprings

why do we consider market demand as indicator of harvesting raised animal/fish?

Answers

Answer:

Following are the solution to this question:

Explanation:

In the given question, the substantial growth throughout stocks and also in agricultural productivity, combined with a growing public understanding of both the important importance of seafood as a food item in a healthy, diversified diet, has led to the upward rise in fish consumption in the last fifty years.

What is the mass number for the following Bohr Model?
e-
e-
e'
P = 11
N = 12
e'
e

Answers

Answer:

[tex]\boxed {\boxed {\sf B. \ 23}}[/tex]

Explanation:

The mass number is found by adding up the nucleons in an atom.

The nucleons are the subatomic particles found in the nucleus, so just protons and neutrons.

There are 11 protons and 12 neutrons.

Add them together.

[tex]mass \ number = protons + neutrons[/tex]

[tex]mass \ number= 11+12[/tex]

[tex]mass \ number= 23[/tex]

The mass number for this atom is 23.

compute the velocity of light in calcium fluoride which has dielectric constant of 2.056 .​

Answers

Answer:

idl low presure but de 2.518 has a 6 divide 8 equal di. ko alam?

As the building collapses, the volume of air inside the building decreases, while the mass of the air stays the same. This means that the _____ of the air inside the building will increase.

Answers

Answer:

Density

Explanation:

HELPP physics final will give brainliest

Answers

0.5 m/s^2

Please give me brainliest! You don’t have to though :3

Which of the following is true regarding the speed of earthquake waves?
OA.
S waves travel faster than P waves and surface waves.
ОВ.
Surface waves travel faster than P waves and S waves.
OC.
P waves, S waves, and surface waves all have the same speed.
OD.
P waves travel faster than S waves and surface waves.

Answers

Answer:

p waves travel faster than s waves and surface waves

Answer:

p waves travel faster than s waves and surface waves

Explanation:

I took a quiz and got this right.

A particle executes simple harmonic motion with an amplitude of 2.00 cm. At what positions does its speed equal one fourth of its maximum speed?

Answers

Answer:

The positions are  0.0194 m  and - 0.0194 m.

Explanation:

Given;

amplitude of the simple harmonic motion, A = 2.0 cm = 0.02 m

speed of simple harmonic motion is given as;

[tex]v = \omega \sqrt{A^2-x^2}[/tex]

the maximum speed of the simple harmonic motion is given as;

[tex]v_{max} = \omega A[/tex]

when the speed equal one fourth of its maximum speed

[tex]v =\frac{v_{max}}{4}[/tex]

[tex]\omega\sqrt{A^2-x^2} = \frac{\omega A}{4} \\\\\sqrt{A^2-x^2}= \frac{A}{4}\\\\A^2-x^2 = \frac{A^2}{16} \\\\x^2 = A^2 - \frac{A^2}{16} \\\\x^2 = \frac{16A^2 - A^2}{16} \\\\x^2 = \frac{15A^2}{16} \\\\x= \sqrt{\frac{15A^2}{16} } \\\\x = \sqrt{\frac{15(0.02)^2}{16} }\\\\x = 0.0194 \ m \ \ or\ - 0.0194 \ m[/tex]

Thus, the positions are  0.0194 m and - 0.0194 m.

The positions where the speed equals 1/4 of its maximum speed is mathematically given as

[tex]x \pm 0.0194[/tex]

What positions does its speed equal one-fourth of its maximum speed?

Question Parameters:

an amplitude of 2.00 cm.

Generally, the equation for the speed of simple harmonic motion  is mathematically given as

[tex]v = w \sqrt{A^2-x^2}\\\\v=\frac{wA}{4}[/tex]

Therefore

[tex]w \sqrt{A^2-x^2}=\frac{wA}{4}\\\\x^2=A^2-A^2/16\\\\x=\sqrt{\frac{15A^2}{16}}[/tex]

[tex]x \pm 0.0194[/tex]

In conclusion, the positions are

[tex]x \pm 0.0194[/tex]

Read more about Speed

https://brainly.com/question/4931057

(1-dimension) A fish has a mass of 6 kg and is moving at a speed of 4m/s to the right. What is its momentum?

Answers

Answer:

24 kg m/s

Explanation:

The momentum of an object can be found by using the formula

momentum = mass × velocity

From the question we have

momentum = 6 × 4

We have the final answer as

24 kg m/s

Hope this helps you

What is the distance between a 900 kg compact car and a 1600 kg pickup truck if the gravitational force between them is about 0.0001 N?

Answers

Answer:

The distance is 0.96m

Explanation:

Given

m1= 900kg

m2= 1600kg

Force F= 0.0001nN

G=6.67430*10^-11 Nm^2/kg^2

Required

The distance r

Step two:

the formula for the force is given as

F = Gm1m2/r2

make r subject of the formula

[tex]r= \sqrt{\frac{Gm1m2}{F} }[/tex]

[tex]r= \sqrt{\frac{6.67430*10^-11*900*1600}{0.0001} }\\\\r= 0.00009610992/0.0001`}\\\\r= 0.96m[/tex]

Answer:

The distance is 0.96m

Explanation:

Given

m1= 900kg

m2= 1600kg

Force F= 0.0001nN

G=6.67430*10^-11 Nm^2/kg^2

Required:

The distance r

Step two:

the formula for the force is given as

F = Gm1m2/r2

make r subject of the formula

[tex]r= \sqrt{\frac{Gm1m2}{F} }[/tex]

[tex]r= \sqrt{\frac{6.67430*10^-11*900*1600}{0.0001} }\\\\r= 0.00009610992/0.0001`}\\\\r= 0.96m[/tex]

Answer:

The distance between the compact car and pickup truck is 0.96048 m

Explanation:

The gravitational force is directly proportional to the product of the masses of the interacting object, it is also inversely proportional to the square of the distance between them.  This is shown in equation 1;

[tex]F =G \frac{m_{1} X m_{2} }{d^{2} }[/tex]............ 1

Where F is the gravitational force = 0.0001 N

G is the gravitational constant = 6.673 x [tex]10^{-11} Nm^{2} kg^{-2}[/tex]

[tex]m_{1}[/tex]  is the mass of the compact car = 900kg

[tex]m_{2}[/tex] is the mass of the pickup truck = 1600kg

d is the distance and its unknown ?

Let us make d the subject formula in equation 1

[tex]d = \sqrt{G\frac{m_{1} m_{2} }{F } }[/tex] .... 2

Substituting into equation 2 we have

[tex]d = \sqrt{\frac{6.673x10^{-11} x 900 x 1600}{0.0001N} }[/tex]

d = 0.96048m

Therefore the distance between the compact car and pickup truck is 0.96048 m

A sled is pulled with a force of 540 N at an angle of 40° with the horizontal. What are the horizontal and vertical components of this force?

Answers

Answer:

Fx = 467.65N

Fy = 270N

Explanation:

Given

Force = 540N

angle of inclination = 40 degree

Horizontal component Fx = Fcos 30

Fx = 540cos30

Fx = 540(0.8660)

Fx = 467.65N

Hence the horizontal component is 467.65N

Vertical component Fy = Fsin 30

Fy = 540sin30

Fy = 540(0.5)

Fy = 270N

Hence the vertical component is 270N

Question 1 of 20
Which statement best describes the effect of the magnet on the block of
material next to it?
is N
O
A. The magnet has magnetized the center of the block.
U
B. The magnet has magnetized the right side of the block.
C. The magnet has magnetized the whole block.
ОО
D. The magnet has magnetized the left side of the block.

Answers

Answer:

B. The magnet has magnetized the right side of the block.

Explanation:

a pe x

Other Questions
AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above 5TH GRADE LEVEL QUESTION: look at photo and answer. A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT Please select the correct conjugation of the verb llamar ("to call") togo in the blank.Yoa sus nios por telfono.llamallamollamasllamamosFill in da blank 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 A 12 N net force is applied to an object as it moves a distance of 3.0 m: Use theWork-Kinetic Energy Theorem to determine the object's change in kinetic energy.Enter your answer in Joules. plz help i need help im failing Two moles of neon gas at 25oC and 2.0 atm is expanded to 3 times the original volume while the pressure is reduced to 1.0 atm. Find the end temperature.A. 447 CB. 174 CC. -66 CD. 38 CE. 150 C Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? 6th grade history i mark as brainliest A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? Why can humans float in space but not on Earth? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Complete each statement by choosing the correct family member that best fits the description.Select the correct answer from each drop-down menu.El padre de mi padre es miEl hijo de mi ta es miLa madre de mi madre es mivEl hijo de mi padre es miLa hija de mi to es mi