i will give a brainlyest and a good rating if you help me out
Read the question and type your response in the box provided. Your response will be saved automatically.

The diagram shows interactions of the Sun, air, Earth’s surface, and water.






1 condensation a ocean

2 precipitation b land

3 runoff c lake

4 transpiration d infiltration

5 evaporation e groundwater

f stream



Part A:The water cycle is driven by heat from the sun.Using evidence from the diagram, explain why scientists are able to make such a claim.


Part B:Identify two processes in the water cycle that are driven by the force of gravity.

I Will Give A Brainlyest And A Good Rating If You Help Me OutRead The Question And Type Your Response

Answers

Answer 1
Where is the question?
Answer 2
f. part a. this is the correct answer

Related Questions

The picture shows a sedimentary rock that was formed from crystalized minerals.

Answers

Answer:

Okay, I agree with your answer!

Explanation:

PLEASEEEEE HELP PLEASEEEEEEE

Answers

I don’t really know to be honest
I can’t really see the designs clearly .

but other than that have a good day !

Which climate has subclimates with humid summers as well as subclimates with long, bitterly cold winters?
polar
tropical rainy
temperate marine
temperate continental

Answers

Answer:

temperate marine

Explanation:

this is the only climate that has mild summers, but cold winters.

A ______________________ is expressed only if both factors are present in an organism.

Answers

A dominant phenotype will be expressed when at least one allele of its associated type is present whereas a recessive phenotype will only be expressed when both allele are of its associated type.
heterozygous i believe

Which of these is NOT part of the nervous system?
¿Cuál de estos NO es parte del sistema nervioso?

Nerve cells
Brain
Bladder
Spinal cord

Answers

Answer:

2. Bladder

Explanation:

The brain, spinal cord and nerves are the part of the nervouse system.

The answer is bladder

Please hurry I need to get this done, please help me I will give you the brain thing and extra points.
image below 10

Answers

Answer: C. A force applied to the cart pushing or pulling it forward

Explanation: (I hope this is correct)

I believe the correct Anwser is C

In sexual reproduction, two individuals produce offspring that have genetic characteristics from both parents. This type of reproduction results in -
Select one:

offspring that are copies of the mother

genetic variation

identical offspring

offspring that are copies of the father

Answers

Answer:

genetic variation

Explanation:

I think identical offspring

coriolis
Which of the following cause the winds to move in the bands on the diagram?

uneven heating of the Earth and the Coriolis Effect

the Earth's rotation and the Earth's revolution

location of the oceans and locations of the mountains

plate movements and high pressure systems

Answers

Answer:

Uneven heating of the Earth and the Coriolis Effect.

Explanation:

Answer:

Number 1

Explanation:

The sun unevenly heats the earth but that would just make it Have two bands insede of  4. The  coriolis effect makes it have the 4.

Please don't be mad if this is wrong

The mass of a bicycle is the same on Earth as it is on the Moon. options: True False if not right no brainliest

Answers

Answer:

false

Explanation:

the reason why is because objects in earth is heavier than on the moon

brainliest plz

help with science----?????///


1. What are the different ways tectonic plates move in relation to each other?

2. What landforms could be the result of converging plates? name a location where this occurs.

3. What landforms could be the result of diverging plates? Name a location where this occurs.

4. What major event could occur as the result of transforming plates? Name a location where this can occur.

5. if crust is constantly created at divergent boundaries, why isn't Earth getting larger?

Answers

Answer + Explanation:

1. The different ways tectonic plates move in relation to each other are:

        convergent (where plates move into one another)  

        divergent (where plates move apart)

        transform (where plates move sideways in relation to each other)

2. Convergent plate boundaries can result in:

       earthquakes, volcanoes, and the formation of mountains.

The Himalaya Mountains are the result of convergent plate boundaries.

3. Landforms that are a result of divergent boundaries are rift valleys and mid-oceanic ridges.

        Locations where this occurs are:  Mid-Atlantic Ridge, Red Sea Rift, Baikal Rift Zone

, East African Rift, East Pacific Rise,  Gakkel Ridge, Galapagos Rise, and Explorer Ridge.

4. Transforming plate boundaries results in shallow earthquakes, large lateral displacement of rock, and a broad zone of crustal deformation.

  A location where this occurs is: San Andreas Fault in western California

sorry that's all I can help you with today :/ if I have more time I'll answer the other questions!! If I helped you please don't forget to mark me brainliest!!

- sophi

changes of state occur when there is a change in:

A. thermal energy
B. Electromagnetic
C. Chemical energy
D. Electrical energy

Answers

Answer:

I believe it is chemical energy

Explanation:

Sorry if I am wrong (rate one star if it is wrong)

Thermal energy: because the word used is ‘state’

help asap. Calcium carbonate is a chemical compound found in rocks and seashells. Its chemical formula is CaCO3. Which of the following statements is true?

Calcium carbonate has three atoms of carbon dioxide.
Calcium carbonate has three atoms of oxygen.
Calcium carbonate has two atoms of carbon.
Calcium carbonate has two atoms of oxygen.

Answers

Answer:

The answer is C!

Explanation:

(Sorry if it didn't help..)

The answer is B
CaCO3 is 1 calcium 1 carbon and 3 oxygen atoms

Which TWO statements are supported by the model?

Answers

Please show more information about this question, like the model.
Share picture please

Describe your theories on time travel. Will it exist? If so, how? If not, explain why.

Answers

Tbh. I feel like the government knows about it but is hiding it. Speed is the key to it all.

Answer:

Personally no...

Explanation:

The ability to go back in time or go into the future could case our measurement of time to shift, and the thin vail of our time could be broken through that soooo yeah

Please answer my question, and please no random things, thank you!! It is not F, That is all I know.
Thank you <3

Answers

Answer:

I think it's i

Explanation:

yes it's i

Answer:

H. Heat energy makes liquid particles move.

Explanation:

The liquid particles start to move beccause of the energyg the heat gives them, this causes the liquid to expand. The most energized particles evaporate off the surface of the liquid, thus turnining the liquid to a gas.

Have a fantastic day, I hope you like the answer given.

Help!!!
This is the last stage and I don't want to screw this up! :(

Answers

Product reactant reactant
Product reactant reactant

What things should be done before demolition begins to keep workers, other people, and other properties safe if a building fell down?

Answers

Answer:

Occupational Safety and Health

Explanation:

For example there should be quick exits in an emergency which includes occupational safety. Plus, there should be medical supplies which explains the need of safety

(Look only at question 4) Match each stage of a star with its definition.

Answers

Black hole is E
Planetary Nebula is D
White Dwarf is E
Neutron Star is B
Supernova is A

Which process begins the formation of sedimentary rock?

the movement of sediment
the cementation of rock sediment
the breakdown of rock into sediment
the buildup of sediment in one location

Answers

Answer:

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock.

Explanation:

Sediment is the term for the component that aids in the formation of sedimentary rock. All of the processes that lead to the sedimentation of organic and mineral particles are together referred to as sedimentation. The cementation of rock sediment forms sedimentary rock. The correct option is B.

What are sedimentary rock?

Sedimentary rocks are created by the material being deposited at the Earth's surface and then being cemented there by bodies of water. Existing rocks or pieces of extinct animals that have accumulated on the surface of the Earth over time generate sedimentary rocks.

Sediment is crushed and cemented as a result of deep sediment burial, creating sedimentary rock. The three types of sedimentary rocks are categorized as Organic, Clastic, and Chemical Sedimentary Rocks. Lime stone, clay, sandstone, etc. are some Sedimentary rocks.

The sediment particle size and fluctuation is the best indicator of the type of rock.

Thus the correct option is B.

To know more about sedimentary rock, visit;

https://brainly.com/question/10709497

#SPJ5

Which correctly lists two characteristics of crystal faces that define crystal systems?

angle and number
number and color
size and hardness
size and angle

Answers

Answer:

A. - angle and number

Explanation:

(>-<)

The size of the crystal faces and the angle between them define the crystal system. Therefore, option (D) is correct.

What is a crystal system?

A crystal system indicates many classes of crystals, space groups, and lattices. In crystallography terms,  crystal system and lattice system are associated with each other. The crystals based on their point groups are divided into seven crystal systems.

The seven-crystal system is the Cubic, Tetragonal, Hexagonal, Orthorhombic, Monoclinic, Triclinic, and Rhomohedral systems. The classification of Seven Crystal Systems is depending upon their lattice and atomic structure.

The size and length of their surfaces which are known as ‘faces’ and sides, and the angles between them, define the shapes of crystals. The cubic crystal system is the most symmetrical as all the angles and the length of the edges is equal.

While the triclinic is the most unsymmetrical crystal system as all the lengths and the angles between faces are unequal.

Learn more about the crystal system, here:

https://brainly.com/question/1212769

#SPJ6

A scientist should be willing to change his or her theory if the evidence does not support it. True or False

Answers

Answer:

Yes, they can.

Explanation:

Science is all about experimentation. If we couldn't redo things, we'd never get anywhere.

Yes they can, evidence is how everything changes.

Out of the 3 of these
Protons Neutron and electrons witch of these are responsible for a charge that can be transformed from one object to another.

Answers

Answer:

Explanation:

Protons determine if an object is what it is

Which is NOT a reason why organisms communicate with one another?

a
To find a mate
b
For protection
c
To find housing
d
To acquire food

Answers

Answer:

C. to find housing.

Explanation:

i hope this helps :)

That would be c to find housing

Please answer my question, and please no random things, thank you!! It is not F, That is all I know.
Thank you <3

Answers

Answer:

You havent attached the choices so we cant tell u the answer

Answer:

I do not see the options but this is what I know.

Explanation:

At the boiling temperature, adding heat energy converts the liquid into a gas WITHOUT RAISING THE TEMPERATURE. In this case, the energy added to the liquid goes into breaking the bonds between the liquid molecules without causing the temperature to change. The same thing happens when a solid changes into liquid.

Please make sure you are correct thank you!!

Answers

Answer:

F.

Explanation:

Steam is a gas formed when liquid is heated.

It’s F bc when it is boiling the particles flow up and gas particles go up into the air

Which of the following bestdescribes what substances are made of atoms?
A.Metals only
B.All matter
C.Gases only
D.Only crystals

Answers

Answer:

B would be it.

Explanation:

Answer:b all matter

Explanation:

Someone fill in the blanks please

Answers

Answer: I think that the food is made from apples.

Explanation: its the most logical statment here, so.

the answer is either molly or joan

SCIENCE!!!! PLEASE HELP!!! 20 POINTS

Answers

Answer:

As the Earth rotates, it also moves, or revolves, around the Sun. ... As the Earth orbits the Sun, the Moon orbits the Earth. The Moon's orbit lasts 27 1/2 days, but because the Earth keeps moving, it takes the Moon two extra days, 29 1/2, to come back to the same place in our sky.

Explanation:

The answer above I believe is correct I was gonna say the same!!! GG

Which type of rock is non-foliated metamorphic rock?

gneiss
limestone
marble
slate

Answers

Marble is non-foliated

pogchamp

the answer is marble

An igneous rock has a coarse texture and is dark in color. How else can this rock be accurately described?

small crystals
cooled quickly
produced from magma
formed at Earth’s surface

Answers

Answer: Produced from magma

Explanation:

C: Produced from magma

Other Questions
Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences. Its an inequality I need the work for it ik the answer Which of the following stimuli is least likely to cause an animal to vomit?A.A bacterial infection in the stomachB.Feeling cold after stepping outsideC.Drinking large amounts of water at onceD.Getting dizzy after spinning in circles do you have any song writing tips answers for both boxes please whats 43.6 rouded to the nest tenth