I thought of a 2-digit number. It's a multiple of 9 and the sum of its digits is five times smaller than the number itself. What is my number?

Answers

Answer 1

Step-by-step explanation:

Since the sum of the digits must be an integer, the number itself must also be a multiple of 5.

Lowest common multiple of 5 and 9 = 45.

Therefore the number could be 45 or 90.

5(9 + 0) =/= 90, so 90 is incorrect.

Since 5(4 + 5) = 45, 45 is the answer.

Answer 2

Answer: 45

Step-by-step explanation:

We know that it has to be a 2-digit number. Its the multiple of 9. We see there is a number in the question. Five. I simply took 9 and multiplied it by 5 which gave me a total of 45.


Related Questions

Item 4
Question 1
Solve −2s<−10. Graph the solution.

Answers

Answer= s > 10/2

s > -10/-2

s > 10/2

if 2t2 eqauls 4 then wah t is 2t4

Answers

2+4 is 8 that should be your answer :)

In quadrilateral PQRS, the exterior angle at Q measures 155 and PS = QR. What measure of ∠PSR would confirm that PQRS is a parallelogram?

Answers

Answer:

The measure confirming that PQRS would be 25

Step-by-step explanation:

It's easier if you draw it down.

1. We need to make this shape a parallelogram and the way we will do that is by making angle Q and angle S the same, because in parallelograms those opposite angles are required to be the same.  

                             \

                        155 \

P \ -------------------------\ Q

    \                         25 \

      \                               \     so that's your shape  

   S   \______________\ R

2.We were given that the exterior angle of Q measures 155, and since exterior and interior angles combined make 180, then we can assume that the interior angle of Q is 25.

3. As mentioned before, in a parallelogram, opposite angles are the same and  therefore PSR (which is just asking for the middle letter, S) is equal to 25 because Q is also 25.  

3s+2p=85.50 4s+2p=123

Answers

Answer:s=10.50 and p=27

Step-by-step explanation:

Nina Milling assembles transistor radios. she is paid $0.54 for each radio assembled during a regular work week, $0.62 for each radio assembled on on sundays. What is Nina's total pay for a week in which she assembled the following number of radios?

Answers

Answer:

I would need to know the number of radios she made each day.

Step-by-step explanation:

lets say she assembled 2 radios a day, which means we would do 0.54 x 2 (that would be 1.08) and then times it by 6 ***not incuding sunday***

you would get $6.48

then for sunday we would do 0.62 x 2 (that would be 1.24) .

now we add 6.48 and 1.24 to get $7.72 a week.

f(x) is a function true or false?​

Answers

Answer:

yes True

Step-by-step explanation:

thank you so much

A rectangular prism has a length of 9 centimeters, a width of 4 centimeters, and a height of 2 centimeters.

What is the volume of the prism?

Answers

Answer:

It will be 72cm

Step-by-step explanation:

Volume of a rectangular prism = (length x width x height) cubic units.

9x4x2=72

answers for both boxes please ​

Answers

Answer:

5 for the green box and 9 for the purple one

Step-by-step explanation:

Answer:

(2,1)

Step-by-step explanation:

2x - 2y = 2

5x + 2y = 12

2x + 5x = 7x

-2y + 2y = 0

2 + 12 = 14

7x = 14

7x/7 = 14/7

x = 2

2x - 2y = 2

2(2) - 2y = 2

4 - 2y = 2

-2y = 2 - 4

-2y = -2

-2y/-2 = -2/-2

y = 1

I'LL GIVE BRAINLIEST TO WHOEVER ANSWERS THE QUESTION CORRECTLY!!!

A.) 6 units
B.) 10.7 units
C.) 5.5 units
D.) 3 units

Answers

Answer:

A

Step-by-step explanation:

Δ NLP and Δ NMO are similar, thus the ratios of corresponding sides are equal, that is

[tex]\frac{NL}{NM}[/tex] = [tex]\frac{NP}{NO}[/tex] , substitute values

[tex]\frac{15+x}{15}[/tex] = [tex]\frac{28}{20}[/tex] ( cross- multiply )

20(15 + x) = 420 ( divide both sides by 20 )

15 + x = 21 ( subtract 15 from both sides )

x = 6

Based on the information given in the diagram, choose all of the statements that are correct.

Answers

Answer:

i think its the last one

Step-by-step explanation:

i think its the last on ig

The true statements from the given statements are -

∠MNP  <   ∠ONP NP ≅ NPOP > PM

What are congruent triangles?

Two triangles are congruent when they have exactly the same three sides and exactly the same three angles.

Given is a triangle as shown in the image.

It is clear that the measure of ∠MNP is less than ∠ONP as

∠MNP = 38°  <   ∠ONP = 39°

The line NP ≅ NP as it is common to both sub - triangles and has same length.

OP > PM since ∠ONP = 39° > ∠MNP = 38°

Therefore, the true statements from the given statements are -

∠MNP  <   ∠ONP NP ≅ NPOP > PM

To solve more questions on congruent triangles, visit the link below-

https://brainly.com/question/27848509

#SPJ6

1) What is the difference between a number and its positive square root is 12. Find the number
2) One of the diagonals of a rectangle is 20cm long. If the difference between its length and width is 4cm, find the area of the rectangle

Answers

Answer:

algebra

Step-by-step explanation:

using algebra form an equation than solve for the variable keep in mind u have to square it

Here are the marks of a student in four exams. 65 80 76 69 The student takes a fifth exam. His mean mark for the five exams is 70 Work out his mark in the fifth exam

Answers

Answer:

mark of the fifth exam = 60

Step-by-step explanation:

Mean = sum of all marks / number of exam

Mean = 70

Number of exam = 5

Let x =

Mean = sum of all marks / number of exam

70 = (65 + 80 + 76 + 69 + x) / 5

Cross product

70 × 5 = (290 + x)

350 = 290 + x

350 - 290 = x

x = 60

mark of the fifth exam = 60

a sports store sells three different packs of tennis balls. which pack is the best to buy? 4 sleeves for 11.49, 6 sleeves for 16.79, 9 sleeves for 22.99​

Answers

Answer:

9 sleeves for 22.99

Step-by-step explanation

The first pack has a unit rate of $11.49/ 4 balls

=$2.8725

The second pack has a unit rate of $16.79/6balls

=$2.798 per ball

the third pack has a unit rate of $22.99/9balls

=2.554

So, I would definitely go for the third pack since it has the least cost.

WILL GIVE BRAINLIEST !! Ella needs at least $360 to pay for her spring break expenses and she is saving $25 from each of her weekly paychecks. How long will be before she can pay for her trip?

Answers

Answer:

At least 15 weeks

Step-by-step explanation:

If Ella needs at least $360, she will have to save her $25 constantly for about 15 weeks.

25*15=375, which is more than 360, so she will have leftover money.

Answer:

2 weeks + 1day

Step-by-step explanation:

7 days a week. 7 + 7 = 14

25 x 14 = $350, missing another 10 dollars.

25 x 15(adding a extra day) = 275.

in change, you have 15 dollars left.

If the graph of f(x)= 3^x is reflected over the x-axis, what is the equation of the new graph?

Answers

Answer:

g(x) = - 3^x

Step-by-step explanation:

Reflection over x-axis results in:

f(x) → - f(x) translation

Therefore the new function is:

g(x) = - 3^x

Solve the perimeter formula for an isosceles triangle, P = 2a + b for a.


a = P + 2b



a = P – 2b

Answers

Step-by-step explanation:

subtract b to get P-b=2a. divide each side by 2 to get (P-b)/2=a

for every 6 white roses, there are 8 pink roses. If the floral arrangement is proportional then how many pink roses are in a arrangement with 10 white roses

Answers

Answer:

13.33 pink roses

Step-by-step explanation:

We are told the floral arrangements are proportional , hence:

6 white roses = 8 pink roses

10 white roses = x

Cross Multiply

6 white roses × x = 10 white rose × 8 pink roses

x = 10 white roses × 8 pink roses/6 white roses

x = 13.333333333 pink roses

x ≈ 13.33 pink roses

Cathy has $100 saved to spend on clothes. She wants to purchase a winter jacket for $40 and some sweaters that cost $20 each. How many sweaters can Cathy buy?

Answers

Cathy can buy 3 sweaters.

The cost of a t-shirt was $30. Now the t-shirt costs $37.50. What is the percent of change? Do the work on your own paper and write your answer as a number.

Answers

Answer:

25%

Step-by-step explanation:

Given that,

Initial cost of a t-shirt = $30

Final cost of a t-shirt = $37.50

We need to find percent of change. The percentage change in any value is given by :

[tex]\%=\dfrac{\text{final value-initial value}}{\text{initial value}}\times 100\\\\=\dfrac{37.5-30}{30}\times 100\\\\=25\%[/tex]

Hence, the percentage error is 25%.

15 POINTS PLEASE HELP!!!

Answers

Answer:

D

Step-by-step explanation:

Solve:
(-5) + (-18) =
A-13
B
--23
C С
23
D
13

Answers

B -23 because adding two negatives keeps the negative on. So add the numbers like positives and then re-add the negative back on

it is -23 I think

Step-by-step explanation:

(-5)+(-18)=-23

6th grade math help me plzzzz

Answers

Answer:

n = 0.8

Step-by-step explanation:

3n + 3 = 5.4

-3 form each side

3n=2.4

÷3 for each side

n=0.8

Answer:

0.8

Step-by-step explanation:

3(n+1)=5.4

Divide both sides by 3

3(n+1)/3 = 5.4/3

simplify

n+1=1.8

subtract 1 from both sides

n+1-1=1.8-1

N=0.8


A lamp is on sale for 10% off the regular price of $159. What is the sale price of the lamp?
$143.10
$145.90
$147.50
$149.00

Answers

Answer:

$143.10

Step-by-step explanation:

$159 (regular price) - 10% = $143.1 = $143.10

Sorry if wrong! Mark brainiest if correct :D Have a great day Luv!

-Bee

Please help me !

Juan drew line segment EF on the coordinate plane. Determine the distance between the points E and F. Round your number to the nearest hundredth

Answers

Step-by-step explanation:

sogzglzotsoypysotaota9t8ts

It would be 120 ye  f  = 8  E = 3 1/2  

Please help!

Look at the system of equations:
y = 2/3x + 10
y = 2/3x − 10
Which of these statements is correct?

A. The system has one solution at (-3,8)
B. The system has one solution at (6,-6)
C. The system has no solution
D. The system has an infinite number of solutions

Answers

Answer:

I  think is C or B

Step-by-step explanation:

Answer: A

Step by step: I did a test and got it right.

Hope this helps!!! - sorry in a rush -

consider this system of equationsY=-1/2x+4 1/2 and 3x -4y=12 solve the system by graphing.Label each graph and the solution ...?HELP

Answers

Answer:

y=x^2

Step-by-step explanation:

200 points down the drain lets see how fast I can get rid of the rest of my 126 points.

How bout a 100 point question? Hehe

Answers

Answer:

lezgoooooooooooooooooo

Answer:

THANK U AHHAH

Step-by-step explanation:

Ryan was paid $75 for
working 6­ 1/4 hours.

How much money
did he make per hour?

A. $12.50

B. $12

C. $15

Answers

Answer:

the answer is b

Step-by-step explanation:

12:

Step-by-step explanation:

Which lengths can be used, directly or indirectly, to calculate the volume of the hexagonal right pyramid? Select three options. XY and ST VU and TW XS and XW TX and WX VU and YZ

Answers

Answer:

XYand ST , VU and TW, TX and WX

Step-by-step explanation:

Volume of hexagonal right pyramid =[tex]\frac{1}{3}[/tex]×Area of base ×height

Area of base =[tex]\frac{1}{2}[/tex]×apothem ×perimeter

if we consider face TXY  ,here height =ST  and  length XY

(b) consider face TVW,  length VU and TW

(d) consider face TWX, length WX and TX  

Hence lengths in options (a),(b),(d) can be used to find the volume of hexagonal right pyramid .

Answer:

A, B, D

Step-by-step explanation:

EDGE 22

Distributive property to remove parantheses -8(-6v+2x-4)

Answers

Answer:

48v - 16x + 32

Step-by-step explanation:

Other Questions
Which of the following Indian commodities was essential to European diet, and a big lure of European action in the Indian Ocean basin A - Pepper B - Salt C- Paprika D - Corn Which graph shows the system of equations{2x+3y=5 4x5y=1 anong mga salita ang maiugnay sa salitang plano A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP Someone pls help me with both :(