Answer:
that is a very good answer is there anymore
Answer:
Thank you!
Explanation:
What is a society that is able to survive and function over a specified time?
Answer:because time and society are different
Explanation:
Describe some of the properties of water and explain how the structure of water is responsible for these properties.
Answer:
The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.
Explanation:
Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis
Answer:
Answer D
Explanation:
just took the test.
Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water
In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?
Answer:
Iodine
Explanation:
Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.
If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.
- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.
Answer:
A) Empezaron a entablar una relación más estrecha con el medio ambiente.
Explanation:
Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.
Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.
Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual
Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.
What are genes?
Genes are composed of DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.
The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.
Genes code for the traits such as the color of eyes, height quality of hair, and more.
Learn more about genes, here:
https://brainly.com/question/31121266
#SPJ2
Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?
Answer:
Hello!
Chromosome 17 is made of over 80 million base pairs.
Approximately how many genes are found on chromosome 17? 1600
Explanation:
Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:
Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies. What are Chromosomes?Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.
Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.
Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.
To learn more about Genes and chromosomes, refer to the link:
https://brainly.com/question/29393001
#SPJ2
To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden
Answer:
To preserve vegetation and soil fertility of land
Explanation:
.
A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
What is nucleotide?It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.
These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder. The type of sugar that is used in a DNA helix is called deoxyribose.
Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.
Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.
Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
Learn more about white blood cells on:
https://brainly.com/question/19202269
#SPJ5
Most abundant element in the biomolecules studied (fats, proteins, carbohydrates, nucleic acids) was....
carbon
Monosaccharide
Amino acid
amino
acid
Explanation:
thats amino acid
What is an advantage to SMRs?
Select all that apply.
less atmospheric emissions
use fusion instead of fission
reduced cost
reduced construction time
Answer:
PLEASE MARK ME THE BRANIEST THANK YOU :)
Explanation:
The next decades are crucially important to putting the world on a path of reduced greenhouse gas emissions.
By the end of the century, demand for energy will have tripled under the combined pressure of population growth, increased urbanization and expanding access to electricity in developing countries. The fossil fuels that shaped 19th and 20th century civilization can only be relied on at the cost of greenhouse gases and pollution.
A new large-scale, sustainable and carbon-free form of energy is urgently needed. The following advantages make fusion worth pursuing.
Abundant energy: Fusing atoms together in a controlled way releases nearly four million times more energy than a chemical reaction such as the burning of coal, oil or gas and four times as much as nuclear fission reactions (at equal mass). Fusion has the potential to provide the kind of baseload energy needed to provide electricity to our cities and our industries.
Sustainability: Fusion fuels are widely available and nearly inexhaustible. Deuterium can be distilled from all forms of water, while tritium will be produced during the fusion reaction as fusion neutrons interact with lithium. (Terrestrial reserves of lithium would permit the operation of fusion power plants for more than 1,000 years, while sea-based reserves of lithium would fulfil needs for millions of years.)
No CO₂: Fusion doesn't emit harmful toxins like carbon dioxide or other greenhouse gases into the atmosphere. Its major by-product is helium: an inert, non-toxic gas.
No long-lived radioactive waste: Nuclear fusion reactors produce no high activity, long-lived nuclear waste. The activation of components in a fusion reactor is low enough for the materials to be recycled or reused within 100 years.
Limited risk of proliferation: Fusion doesn't employ fissile materials like uranium and plutonium. (Radioactive tritium is neither a fissile nor a fissionable material.) There are no enriched materials in a fusion reactor like ITER that could be exploited to make nuclear weapons.
I HOPE YOU LIKE MY ANSWER THANK YOU:)
Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines
Answer:
c.
composting
Explanation:
Composting is not a technological way of improving air quality (Option C).
What is air quality?Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.
Air quality is fundamental for maintaining overall health and increasing the quality of life.Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).In conclusion, composting is not a technological way of improving air quality (Option C).
Learn more about air quality here:
https://brainly.com/question/1211889
BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain
Answer:
October
Explanation:
October is one of the hurricane season months
What is the electrical charge of the nucleus of an atom that has 11 protons , 12 neutrons , and 11 electrons ?
Answer:
The 11 positive protons cancel out the 11 negative electrons, and the overall charge of the atom is zero. So it neutral
Explanation:
I hope this helps!!
The nucleus of an atom has only protons and neutrons. Since the neutrons are neutral, the charge on the nucleus, in this case, would be +11.
What is the atomic charge?The difference between the number of electrons and protons in an atom is defined as the charge on that particular atom. An atom has three sub-atomic components. These are electrons, protons and neutrons.
The electrons are negatively charged, the protons are positively charged and the neutrons are neutral.
Because the neutrons are neutral, the increase or decrease in the number of electrons or protons affects the charge on an atom. If the number of protons is higher, the atom will be positively charged. If the number of electrons is higher, the atom will be negatively charged.
The protons and neutrons are present in the nucleus of an atom and the electrons are present in atomic shells.
Therefore, in a nucleus with 11 protons, and 12 neutrons, the charge will be +11
Read more about atomic charge, here https://brainly.com/question/5308494
#SPJ6
In the United States, most racial discrimination comes in the form of ________ discrimination.
A. Direct
B. overt
C. indirect
D. extra
Answer:
C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.
Explanation:
In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.
What is indirect discrimination?Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.
Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.
Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.
Therefore, indirect discrimination is the most common form of discrimination observed in the United States.
Learn more about indirect discrimination here:
https://brainly.com/question/14710203
#SPJ7
Which of the following processes begins when a star enters the main sequence?
a
Nuclear fission
b
Nuclear fusion
c
Condensation of a nebula
d
Appearance of a supernova
Answer:
i believe it is B: Nuclear Fusion
Explanation:
Answer:
C. Nuclear Fusion
Explanation:
I am 1000000000% sure this is correctamundo, stay cool, and have a great day!
Plant cells are classified as
pluripotent
omnipotent
multipotent
totipotent
Answer:
pluripotent i think sorry if I'm wrong
The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.
Answer:
Explanation:
In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.
Which of the following statements regarding prokaryotic and eukaryotic cells is true
Answer:
I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells
Answer:
They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.
Hope this helps, have a great day/night, and stay safe!
Small aquatic organisms, such as coral, are the producers of the ocean.
Please select the best answer from the choices provided true or false
Answer:
true
Explanation:
on edg
Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.
What is aquatic organism?The term aquatic organism has been defined as the the organism lives in the water is known as the aquatic organism. The corals are essential part of the marine ecosystems. They are feeding upon zooplankton, but also their polyps get sugar that is produced by the algae living on them. Also, the corals provide much needed shelter for lots of marine animals, but also are on the menu of some, like the starfish for example.
Limestone is in form of sedimentary rock that is made up of skeletal fragments of marine organisms such as forams, corals and molluscs. However, limestone is formed from the shell of an organisms because the shell is made up of calcite or aragonite.
Due to the presence of nutrients that swipe from ocean to the shores along with tides which makes predators to be present along the shores which ultimately pose a threat to coastal aquatic organisms.
Therefore, Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.
Learn more about aquatic organisms on:
https://brainly.com/question/1397242
#SPJ6
compare the chemical equations for photosynthesis and cellular respiration explain how the two processes are interrelated
Answer: Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water
Explanation:
Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5
Answer:
C
Explanation:
Took it
has anyone done this worksheet? i need help with it. thanks:)
Which of the following problems are environmental indicators of acid deposition?
Decreased pH levels in lakes and rivers
Decreased concentration of aluminum in the soil
Changes in development of indicator organisms of an ecosystem
II only
III only
I and III
I and II
Answer:
I and III
Explanation:
Acid deposition will decrease pH levels in lakes and rivers since it contaminates them and lowers their pH, and organisms may be affected by the increased acidity in their immediate surroundings, but aluminum has nothing to do with pH levels at all.
Hope thish elped!
Option I and III shows the problems of environmental indicators of acid deposition.
The following information should be considered:
The acid deposition should reduce the level of pH in terms of lakes and rivers as it contaminates also the organisms should impact when the acidity should be increased for the surroundings. But the aluminum does not have any relationship with pH levels.Therefore we can conclude that options I and III are correct.
Learn more: brainly.com/question/13107711
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.
Explanation:
During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.
Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.
Which statement best describes homeostasis in a cell?
A. Molecules are in equilibrium (balance) inside and outside the cell
B. Active transport causes molecules to move from low to high concentration the molecules are un-equal
C. Pathogens enter cells and infect those cells, causing them to malfunction
D. Cells do not maintain homeostasis with their external environments.
Answer:
I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.
Explanation:
Compare asexual and sexual reproduction. Place each statement into the correct box.
Answer:
Explanation:
asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female
Answer:
During asexual reproduction, the organism that is reproducing spits in two.
A sea anemone reproduces asexually.
During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.
Humans reproduce sexually.
Explanation:
Its easy! If right will give brainlist! Don't overthink..:) Just answer
The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks
Answer:
When the mirror is inside the focal point..?
People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis
Answer:
C. have medical insurance
Explanation:
People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.
The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.
What is the diagnosis?The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.
Thus it is well explained.
To learn more about the medical insurance refer to link :
https://brainly.com/question/1941778