How would a geologist use absolute dating to determine the age of sedimentary layers? by dating the age of intrusions and extrusions near a sedimentary rock layer by comparing the relative ages of several sedimentary rock layers by identifying fossils in nearby intrusion and extrusions and determining their age

Answers

Answer 1

Answer:

Radiometric dating methods

Explanation:

Absolute dating is the process of determining an age on a chronological or specified time scale in which events occurred in archaeology and geology. Absolute dating can be determined by using properties of the atoms that make up materials.

The most common method of absolute dating uses by geologists is radiometric dating methods which is based on the natural radioactive decay of certain elements such as potassium and carbon found in the rocks. By comparing the ratio of parent isotope with a known half-life to daughter product in the rock, the age of the rock can be determined.

The carbon-14 isotope is used in radiocarbon dating, but is only useful for measuring recently formed rocks in the geologic past. The decay of Potassium-40 isotope known as potassium-argon (K-Ar) method allows dating of materials that up to 1,000 billion years old.

Answer 2

Answer:

by dating the age of intrusions and extrusions near a sedimentary rock layer

Explanation:

got it right on the assighment


Related Questions

Someone help me pleaseee with the answers to both of em

Answers

The answer is “The Nervous System”

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

what is the key to natural selection ?

Answers

Answer:

Survival of the fittest?

The top one should be right

Which of the following can cause the extinction of a species?
climate change
catastrophic events
interactions with other species
human activities

Answers

Answer: human activities

Explanation:

What are the effects of greenhouse gases on Earth?

Answers

Answer:

greenhouse gasses get trapped in the atmosphere and contribute to global warming

Answer: The greenhouse effect is the process by which radiation from a planet's atmosphere warms the planet's surface to a temperature above what it would be without this atmosphere.

Explanation:

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

The first line of defense involves which structure(s)?
OT-cells
O skin
O blood
OB-cells

Answers

Answer:

skin

Explanation:

The skin is vital for our general health and well-being. In addition to acting as the body's first line of defense against bacteria and viruses, healthy skin also maintains fluid balance and helps regulate body temperature. She is very sensitive, she recognizes the slightest touch as well as pain.

As an outer layer that we can see and touch, the epidermis protects us from toxins, bacteria, and fluid loss. It consists of 5 sublayers of keratinocyte cells. These cells, produced in the deepest inner, basal layer, migrate to the surface of the skin. As they do so, they mature and go through a series of changes.

If an organism has 30 chromosomes in its body cells, how many chromosomes would it have in its sex cells (gametes)?

Answers

Answer:

15

Explanation:

Gametes have half the amount of dipliod somatic ells

Which of the following statements about eukaryotic cells is NOT
true?
Eukaryotic cells have a membrane-bound nucleus
Eukaryotic cells are more complex than are prokaryotic cells.
Eukaryotic cells are believe to
e evolved more recently than
prokaryotic cells.
Eukaryotic cells are usually smaler than prokaryotic cells

Answers

Answer:

Eukaryotic cells are believed to be evolved more recently than prokaryotic cells.

Explanation:

The statement about eukaryotic cells is NOT true - Eukaryotic cells are usually smaller than prokaryotic cells

Cells are fundamental units and are mainly two types eukaryotic cells and prokaryotic. There are various structural and functional differences and similarities found in them.  

Prokaryotes and eukaryotic cells have the following difference:  

Prokaryotic cells lack a true nucleusProkaryotic cells lack other membrane-bound organelles.Eukaryotic cells have more organelles, enzymes, and molecules, therefore, prokaryotic cells are simpler.Prokaryotic cells are comparatively smaller than eukaryotic cells.Prokaryotic cells are evolved before eukaryotic cells.

Thus, the statement about eukaryotic cells is NOT true - Eukaryotic cells are usually smaller than prokaryotic cells

Learn more about eukaryotic cells:

https://brainly.com/question/773012

Some viruses attack cells by inserting their own DNA into the host cells’ DNA. Why might it be simpler for these viruses to attack prokaryotic cells than eukaryotic cells?
A. Prokaryotic cells have less DNA than do eukaryotic cells.
B. The rapid growth of prokaryotic cells generates more viruses.
C. Unlike eukaryotic cells, prokaryotic cells do not have a nucleus.
D. The cell wall in prokaryotic cells is a less effective barrier.

Answers

Answer:

C

Explanation:

Because eukaryotes have membrane bound nucleus where they store their generic information

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

What are the building blocks of proteins? If all proteins are made of the same
building blocks, how can there be so many different types of proteins with different
functions?

Answers

Answer:

The basic building blocks of proteins are called amino acids. In proteins, amino acids are arranged into a linear molecule called a polypeptide chain. Some proteins only consist of a single polypeptide chain while more complex proteins are made out of multiple polypeptide chains bonded together.

Explanation:Proteins are formed out of long linear molecules of amino acids called polypeptide chains. The identity and function of a protein are determined by its sequence of amino acids and the 3-D structure of its polypeptide chains. Amino acids are stored in DNA in the form of sequences of nucleotide bases.

Which of the following is found in the cells of
fungi but NOT of archaebacteria?
A ribosomes
B cell membrane
C DNA
D nucleus

Answers

Answer: im 90% sure its (d)

According to the question option "D" Nucleus is found in the cells of fungi but NOT of archaebacteria.

What is the difference between fungi and archaebacteria?

Fungi cell walls usually are constructed of chitin whereas Eubacteria cell walls have peptidoglycan.

Archaebacteria do not have either substance, although the cell walls of some archaebacteria contain a substance similar to peptidoglycan.

Thus, the option "D" Nucleus is found in the cells of fungi but NOT of archaebacteria.

To learn more about  fungi and archaebacteria click here:

https://brainly.com/question/5186929

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

In which cellular organelle is genetic information (DNA) held?
A. Mitochondria
B. Ribosomes
C. Cell membrane
D. Nucleus

Answers

Answer: d. nucleus

Explanation:

the answer is D
the nucleus holds all dna

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

Why are packed juices contaminated with yeast

Answers

Answer:

It is because yeast is responsible to fix the carbon dioxide.

Because of o2
Is responsible

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

Explain how specific proteins are formed from a strand of mRNA.

Answers

Answer:

During translation, ribosomes move along an mRNA strand, and with the help of proteins called initiation factors, elongation factors, and release factors, they assemble the sequence of amino acids indicated by the mRNA, thereby forming a protein.

Explanation:

Answer:

Explanation:

Los ARN mensajeros, también conocidos como ARNm, son uno de los tipos de ARN que se encuentran en la célula. Éste en particular, como la mayoría de los ARN, se sintetiza en el núcleo y luego se exporta al citoplasma, donde la maquinaria de traducción, la maquinaria que realmente fabrica las proteínas, se une a las moléculas de ARNm y lee en ellas el código para producir una proteína específica. Así que en general, un gen, el ADN de un gen, puede ser transcrito en una molécula de ARNm que puede acabar dando lugar a una proteína específica.

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

What make a dwarf planet different from a planet?
A.
Dwarf planets are usually smaller than the moons of a planet.
B.
Unlike planets, dwarf planets do not have natural satellites.
C.
Planets have cleared their orbital paths of debris, while dwarf planets have not.
D.
Planets have a nearly spherical shape, while dwarf planets are irregular in shape.
E.
Dwarf planets do not orbit in the same plane as the other planets.

Answers

Answer:

Dwarf planets are usually smaller than the moons of a planet.

Explanation:

Answer: C

Explanation: dwarf planets lack the gravitational forces needed to pull in and accumulate all of the material found in their orbits.

edmentum-2022

Which one is the correct answer?? The lined squares in the Punnett square represent____.

Answers

They represent the parent's genotypes.

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son
Other Questions
Question 14An element's periodic table identity is defined by its number of.neutrons.Bisotopes. Celectrons.protons ASAP HELP!!!!! For earth science What is the phase of a star called where it simply cools and fades away? list two examples of temporary change in human Who became the first governor to be inaugurated in the New Capitol in 1904? 1. How did Jeannette catch on fire in the beginning of the novel? *1 pointa. She was making herself pasta while Rose Mary watched and painted.b. She was testing chemical reactions with toxic chemicals in a shed near her house.c. She was throwing toilet paper that was on fire down the toilet.d. She was cooking hot dogs by herself. 3Which statement below best completes the chart?Water shortages occurred as more people moved to rural areas4Air pollution levels increased as governments eased regulationsCities grew in size as previously used farmland was absorbed by rural areas5Cropland eroded as farmers used outdated technique Joe would have earned $504 for working a 42 hour week but he was sick and missed 4 hours. How much did he earn? Help asap please!! I will mark you as brainliest :) As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent