How to make a girl fall in love with her?​

Answers

Answer 1

Answer:

depends on what she likes. Just be nice i guess

Explanation:

Answer 2

Answer:

I just say do what she want's you to do like if she is sad but she like sweets go get her sweets and flowers

Explanation:


Related Questions

An idea in science is supported or rejected after several

Question 23 options:

publications

experiments

alterations

meetings

Answers

Answer:

experiments

Explanation:

Answer:

experiments

Explanation:

I took the test

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.

Answers

Answer: Its A my friend, how it helps!.

Explanation: I just completed the Test.

The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.

What do you mean by adaptation?

In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.

The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.

Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.

Learn more about adaptation:

https://brainly.com/question/12534888

#SPJ2

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

3.4.3 Lab: Why are cells so small?

Answers

Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.

Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.

The cells are so small because their small size allows them to take in food and get rid of the waste.

The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.

Learn more about cell:

https://brainly.com/question/3142913

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

I need help. Due today.

Answers

Answer:

D) common ancestry among vertebrate species

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Is a seed a living organism

Answers

Answer:

Yes they are living organisms

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

And, what else it literally says CHECK ALL THAT APPLY like....

Answers

Answer:

i dont understand??????

Explanation:

Answer:

What??

Explanation:

This makes no sense to me...

Help I need helpppppppoo

Answers

meters per second. distance is meters and time is seconds
meters per second I’m right

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

(I will give a Brainliest) Can liquid water and steam exist at 100°C?

Answers

Yes It can.

Hope it helps (:

Answer: yes it can!

Explanation: hope you get a good grade!

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?​

Answers

Answer:

Add magnet to the bowl, cover the bowl, and shake well

Explanation:

Anything with MAGNET

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.

Answers

Answer:

1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion

The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.

What are hypothesis?

A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.

Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.

Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.

The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.

A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.

Thus, by using these steps, scientist can come to an end for the problem.

For more details regarding hypothesis, visit:

https://brainly.com/question/17173491

#SPJ2

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

Other Questions
Can someone help me pleas Word count: 200+ wordsIntroductory sentencesConcluding sentencesSupporting details:Who was the inventor?What did he invent?Where did he invent it?When did he invent it?How does it work? Why did Amal feel guilty about his skateboarding accident?O His mom had to take him to the hospital and missed her nursing class.O He had been hurt doing exactly what his mom asked him not to do.His mom had to care for him while he healed so she couldn't study. A company provides commisssion to its agent at the following rate.-0.5% in the sale upto Rs.15 lakh-1% in the sale from 15 lakh to Rs.25 lakh-1.5% in the sale from Rs.25 to Rs.40 lakh-2% in the sale above Rs.40 lakhcalculate the amount of commission that can be obtained from the following sale amount by using the above rate of commissiona.Rs.12 lakhb.Rs.24 lakhc.Rs.38 lakhd.60 lakh Please help me ASAP Can anyone give me 1-2 sentences for an opening to a story relating to this picture? Will give brainliest for the best one:) Select the correct answer.Which group of words from the selection conveys the author's tone about his topic?A.alarming, dark, pessimistic B.valluring, complex, refreshingutC.creative, simplistic, optimisticD.critical, downtrodden, foreboding PLEASE HELP MEEEEEEPlease choose any the book you want. Here are the questions1.Do any of the characters remind you of someone in your life?2.Who and how? Helppppppppppppppppppp Why were some people angered by the slogans printed on two of Old Navy's T-shirts? 2 examples of peer pressure in The Sneetches How do the dwarfs react to Snow White's appearance in their home?A: The dwarfs demand that Snow White leave the cottage and return to the woods.B: The dwarfs are relaxed because they are used to visitors.C: The dwarfs admire her beauty and leave her undisturbed.D: The dwarfs are angry when they realize that their beds have been slept in. ILL GIVE BRAINLYIn this political cartoon, created by Benjamin Franklin as the French and Indian War began, what do the parts of the snake represent?A. colonies bordering Spanish territoryB. French colonies in North AmericaC. The Southern ColoniesD. English colonies in North America In what ways was the Hundred Years War a new kind of war A: it was caught between nations that were becoming unified states B: it was fought between two religions. Christianity and Islam. Rather between different countries. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA what is 0.41891891891892 to two significant figures? I. Fill in the blanks below with the appropriate vocabulary in Spanish. Think about what you have learned so far.1. Es necesario estudiar mucho. = que estudiar mucho.2. Lo . No puedo ir al cine contigo.3. No voy a tomar un taxi. Voy a tomar (the bus).4. Voy a tomar el en la playa.5. Los domingos, mi familia y yo vamos a la .6. Necesito dinero. Voy al .7. Me encanta la msica! Me ir al concierto contigo.8. El metro = 9. Me gusta novelas.10. A mi hermano le gusta cartas.II. Answer the following questions with complete sentences in Spanish. When there are clues provided, use them in your answer.1. Adnde vas para comprar libros?2. Adnde van Uds. para ver una pelcula?3. Qu tienes que hacer hoy? (read a novel)4. Qu vas a hacer esta noche? (go to the museum)5. Tell someone who invites you somewhere that you are sorry but you have another engagement.6. Tienes que estudiar mucho?7. Van Uds. al correo para mandar una carta?8. Tell a friend that you would love to go to a club to dance.9. A qu hora vas a ir a la biblioteca para estudiar? (6:30)10. Por qu vas a la panadera? (I have to buy bread.)thank you! solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish