How much time would it take to perform 3200 J of work with a power
output of 160 Watts

Answers

Answer 1

Explanation:

p =w/t

160=3200/t

t=3200/160

t =20second


Related Questions

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

1) Read the following paragraph and answer the following questions.
The countries which do not have oil reservoirs in their land, import oil from other countries. But sometimes during transportation of oil through sea routes, accidental oil spill occurs. This oil spilled in the ocean may prove fatal and toxic to aquatic animals. Therefore, removal of this spilled oil is essential for protection of aquatic life. For removing this oil layer, certain microbes like Pseudomonas spp and Alcanivorax borkumensis are used. These microbes have the ability to destroy the pyridines and other toxic chemicals. The hydrocarbonoclastic bacteria (HCB) are able to decompose the hydrocarbons and bring about the reaction of carbons with oxygen resulting in formation of CO​2​ and water. Like oil spills cause damage

to aquatic life, plastic forms the major part of the garbage on the land. Plastics are difficult to degrade as they are made up of PET, by research various species like Vibrio and Ideonella sakaiensis which can degrade PET have been identified. There are certain species of microbes which can decompose rubber from garbage.
a) How are aquatic organisms affected by oil spills in the ocean?
b) Which type of chemical compounds are degraded by microbes used for
clearing oil spills?
c) Name any two species of microbes which can degrade rubber from
garbage.
d) Why should there be a ban on plastic bags?

Answers

Answer: See explanation

Explanation:

a) How are aquatic organisms affected by oil spills in the ocean?

Aquatic organisms are affected by oil spilled as it is fatal and toxic to them. It can cause death, habitat degradation, vulnerability to predators and can also lead to the inability to hatch their eggs.

b) Which type of chemical compounds are degraded by microbes used for

clearing oil spills?

The chemical compound degraded by microbes are clearing oil spills are Pseudomonas spp and Alcanivorax borkumensis.

c) Name any two species of microbes which can degrade rubber from

garbage.

These are Vibrio and Ideonella sakaiensis.

d) Why should there be a ban on plastic bags?

There should be a ban on plastic bags as they're difficult to degrade as they are made up of PET.

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

state the taxonomic family to which the virus that causes EVD belongs​

Answers

Ebolavirus, genus of viruses in the family Filoviridae, certain members of which are particularly fatal in humans and nonhuman primates. In humans, ebolaviruses are responsible for Ebola virus disease (EVD), an illness characterized primarily by fever, rash, vomiting, diarrhea, and hemorrhaging.

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Which of the following is NOT an example of a biotic factor in an ecosystem?
F.
Grasses
G.
Bacteria
H.
Beetle
J. Water

Answers

the answer is h. beetle

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

Explain how organisms in both of the ecosystems are dependent on their environmental interactions with other living things and with nonliving factors.

Answers

Answer:

Explanation:Organisms, and populations of organisms, are dependent on their environmental interactions both with other living things and with nonliving factors. ... Mutually beneficial interactions, in contrast, may become so interdependent that each organism requires the other for survival.

The organism that considered for an ecosystem that should be dependent on the environmental interactions should be explained below,

Environmental interactions:

The organism and the organism population should be based on the environmental interactions along with the other living things also even with the non-living things of factors.

On the other hand, Mutually beneficial interactions should be considered as the independent where each and every organism should needed other for the survival purpose.

learn more about an organism here: https://brainly.com/question/18167856

Compare cladistics with Linnaeus's classification

Answers

Cladistic is the arrangement of organisms according evolution, while in linear taxonomy, organisms are classified on the basis of similarities.

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

How many sugar phospha te backbones are in one strand of DNA?

Answers

Answer: Two

Explanation: In double-stranded DNA, the molecular double-helix shape is formed by two linear sugar-phosphate backbones that run opposite each other and twist together in a helical shape. The sugar-phosphate backbone is negatively charged and hydrophilic, which allows the DNA backbone to form bonds with water.

distinguish between active and passive immunity​

Answers

Answer:While active immunity occurs when an individual produces antibodies to a disease through his or her own immune system, passive immunity is provided when a person is given antibodies.

Explanation:

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

during an experiment scientists study a portion of a gene found in the white mouse. they determined that the following sets of codons has been translated into a series of three animo acids shown below
mRNA sequence- GCA-UUA-UCG
amino acids sequince- alanine - leucine - serine
which of the following would be the expected outcome of this same set codons were to be found in humans genes
The human cell would be unable to translate the mRNA codons.

The sequence of amino acids would be completely different in the human.

The amino acid sequence would be identical in the human cell.

The human cell would be converted into a mouse cell.

Answers

Answer:

the amino a acid sequence would be  identical to human cell

becuuse the codes sequencing is simialr in all animals

clearing of these has a harsh effect on animal population. What is it called?

Answers

Trees I’m guessing is the answer

What changes occur in taste receptors when the membrane is depolarized during receptor potential A. Voltage-gated Ca2 channels open, triggering the release of neurotransmitter. B. Voltage-gated Cl- channels open, triggering the release of neurotransmitter. C. Voltage-gated Ca2 channels open, inhibiting the release of neurotransmitter. D. Voltage-gated Cl- channels open, inhibiting the release of neurotransmitter.

Answers

Answer:

A. Voltage-gated Ca² channels open, triggering the release of neurotransmitters.

Explanation:

For taste mechanisms to function properly, it is necessary the activation of taste receptors.  

Through the activation of taste receptors, transduction cascades occur, involving ion channels that are located in the apical or lateral membranes. There occurs a subsequent release of chemical neurotransmitters that send signals to the control centers.

Salty and sweet flavors produce the membrane depolarization that results in Ca+ ions´ entrance to the cell. Ca+ initiates the release of neurotransmitters. Afferent gustative neurons receive the message and send it to the control center, the encephalon. After that, gustative cells go back to the initial state, repolarizing.

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

how do the two sets of muscles work together to make air enter the lungs

Answers

Answer:

Here you go

Explanation:

downward toward the abdomen, and the rib muscles pull the ribs upward and outward. This makes the chest cavity bigger and pulls air through the nose or mouth into the lungs.

Other Questions
A popular game requires the player to select the same five numbers out of a set of allowed numbers that will be drawn at random by the lottery commission. For the next game, if you select the five numbers that won in the most recent prior drawing, your chances of winning will: Suppose you have read two different books on World War II, and each book has different arguments about how the war started. Which of the following best describes the stronger historical argument? Joshua is going to invest $9,000 and leave it in an account for 5 years. Assuming theinterest is compounded continuously, what interest rate, to the nearest tenth of apercent, would be required in order for Joshua to end up with $12,500? Submit your nota bene paragraph (5-7 sentences) about a current event in your life. Use as many of your spelling wordsas you can, and check that you spell them correctly and underline them.Word bank: benefactor, benevolent, benediction, beneficiary, benefactress, beneficial, benefit, beneficence, glacier,environment Write 2 paragraphs about Why Winter is better than Summer. Which situation can be represented by this ineqality? [tex]12\leq 12k+29[/tex]A. Felicia has 12 buttons in her collection. She will collect 29 new buttons every year. Felicia collects buttons for k years. For what values of k will Felicia have at least 120 buttons. B. Felicia has 29 buttons in her collection. She will collect 12 new buttons every year. Felicia collects buttons for k years. For what values of k will Felicia have at least 120 buttons.C. Felicia has 29 buttons in her collection. She will collect 12 new buttons every year. Felicia what values of k will Felicia have at most 120 buttons?D. Felicia has 12 buttons in her collection. She will collect 29 new buttons every year. Felicia collects for k years. For what values of k will Felicia have at most 120 buttons? Which of the following is NOT acomplete sentence?A. Completing tasks one at a time allows you tofocus on the task at hand and be more efficient.B. Many people are still conditioned to thinkthat multitasking is more effective.C. Even though it is better to do tasks one at atime instead of multi-tasking. Explain in a paragraph how speed and velocity impact blood splatterPlease no links! The reason for using 1-propanol as the solvent of choice for recrystallization is that triphenylphosphine oxide is more soluble in 1-propanol than the alkene product because triphenylphosphine oxide can use its oxygen to hydrogen-bond to 1-propanol, whereas the alkene has no hydrogen-bonding capability. Triphenylphosphine oxide, therefore, is removed based on its polarity and H-bonding ability.a. Trueb. False Names for cuts of game meat are different from those of meats you find in the grocery store.TrueFalse How can economic development be balanced with resource sustainability? Evaluate x^4.x^2 when x=5 A 100 watt bulb with 60 volts has a current flow of how many Amps? If a 75 W lightbulb is 15% efficient, how many joules of light energy does the bulb produce every minute? Question 20 A retired couple invested $6000 in bonds. At the end of one year, they received an interest payment of $402. What was the simple interest rate of the bonds? How much money does the state of Tennessee each year 8. If a person is very noisy and active in a lively way, you might describe them asA. boisterous.B. insipid.C. repugnant.D. morose. state any one way of controlling the spread of ringworms among children Plz I need helpNueve mil seiscientos cuatro = Dos mil cuatrocientos Mil cuatrocientos Tres mil doscientos Un mil doscientos Can you please plz help me