How many of yall go to any acadia parish schools in louisiana???

Answers

Answer 1

Answer:

answering for the points

Explanation:


Related Questions

Subject-verb agreement The students elected to lead our school beautification committee has several inspiring ideas including a mural in the gym and the relocation of the garbage cans from near the school entrance to behind the cafeteria

Answers

We are supposed to find the error in the sentence concerning subject-verb agreement.

Answer:

The students elected to lead our school beautification committee HAVE several inspiring ideas including a mural in the gym and the relocation of the garbage cans from near the school entrance to behind the cafeteria.

Explanation:  

What we must realize about the verb "to have" in the sentence is that its subject is not "committee". The ones who have inspiring ideas are actually the students. Therefore, the verb should agree with the subject "students", which is plural. The form "has" is singular, and that is why it is incorrectly used. The correct form is:

The students elected to lead our school beautification committee HAVE several inspiring ideas including a mural in the gym and the relocation of the garbage cans from near the school entrance to behind the cafeteria.

Answer:

i just answered it on ixl its have

Explanation:your welcome

MEED HELP ASAP...examine the graphic in the text the identify the type of graphic used and explain how this graphic enhances the meaning of this text..
Passage In order to address the growing issue of medical absences in the sixth grade at Grover Middle School, I recommend a two-part plan. First, we should hire a professional deep-cleaning service to scrub down the sixth-grade classrooms. Then, we should have an assembly for the sixth graders where the school nurse talks about basic strategies for not spreading germs. I know these are drastic measures, but the numbers don't lie, and the sooner we put this plan into action, the sooner we'll finally have sixth-grade classrooms full of healthy kids ready to learn.​

Answers

Answer:

The graphic is a step by step graphic. Because of the words then and first. The meaning of this text and graphic is to show the steps of keeping specifically sixth graders healthy. They show this by showing the steps of the action they are going to take to help try to prevent sixth graders getting sick.

Hope this helps! <3

Select the correctly punctuated sentence.

"I had hoped," Bill said, "that I could play Captain Courageous in the play."
"I had hoped, Bill said, that I could play Captain Courageous in the play."

Answers

Answer:

A."I had hoped," Bill said, "that I could play Captain Courageous in the play."

Explanation:

it is this one because the quotations are in the correct place, whereas B's quotations are only at the beginning and end, and i doubt that in the middle of his sentence, he said "Bill said". this is why the answer is A.

"I had hoped," Bill said, "that I could play Captain Courageous in the play." is the correctly punctuated sentence. Thus, option A is correct.

What is a sentence?

The portion of a sentence that contains the phrase and the words is known as the sentence. Frequently, this has both a subject and a predicate. It must be grammatically proper for a sentence. Additionally, all necessary punctuation should be used in a sentence. Either a noun or a pronoun may be present. The sentence aids in conveying the ideas.

This is the case since the citations are placed where they belong, as opposed to B, who only uses references at the beginning and the conclusion of his sentences.

To provide the reader with detailed details, like when a sentence finishes, whether as well as not it is a query, and when a group of words can be a list, punctuation is used in sentences.

Therefore, option A is the correct option.

Learn more about the sentence, here:

https://brainly.com/question/27891489

#SPJ2

3. Let's put the camera on this so that it won't wiggle as much!
A) quadruped B) peddler
pedestrian
D) tripod
4. Most bicycles have two of these that make the wheels turn around
A) pedals B) peddlers
impediments D) pedestrians
5. Gerald looked through the peek hole in his front door and saw one of these holding a
box of candy
A) pedestrian B) millipede C) quadruped D) peddler
6. Did you see Chloe's pet? It must have a thousand legs! It's one of these.
A) centipede B) quadruped C) millipede D) biped
7. Logan, Zack, and Ryan are smart. They always look both ways and use crosswalks.
What are they?
A) peddlers B) pedestrians centipedes D) quadrupeds
8. Tanya jumped when she saw one of these crawling across her living room! She's sure it
had a hundred legs!
A) centipede B) millipede Cbiped D) quadruped
9. Although Marissa walked with a limp, she didn't let this
A) impediment B) pedestrian C) peddler
get in her way
D) pedicure
10. Most of these living things walk upright rather than crawling
A) bipeds B) quadrupeds C) millipedes
D) peddlers

Answers

Answer:

3.D

4.A

5.D

6.B

7.B

8.A

9.A

10.A

Explanation:

Only need help with the last 2 question and the element I choose is oxygen


Atomic Structure and Forces Activity
Introduction
The periodic table provides a wealth of knowledge about every known element. From the table, you can learn about an element’s physical and chemical properties, such as its available valence electrons or reactivity with other elements. Using terminology and information from the lesson, you will conduct an “interview” with an element and publish what you discover about its properties and bonding capabilities.
Procedures:
Choose an element from the periodic table to interview.
Conduct research on your element. Use the following as a guide for the kind of information you need to learn about your element to successfully complete the assignment.

Atomic number
Atomic mass
Symbol
Number of subatomic particles
Its position on the periodic table and its chemical properties based on that position
Typical compounds formed by your element
The history of your element's discovery
Five uses for your element or its common compounds
Where your element or its compounds can be found in the real world
At least one photo or drawing of your element

Arrange the information into a coherent interview that consists of an introduction followed by alternating questions (to the element) and answers (from the element).
Use a magazine layout or similar format to present the interview. You may choose to complete the layout of the project with art supplies or using a computer or online resource.
Be sure the work is your own and you include citations for each of the resources included.
Conclude with a summary paragraph that answers your reflection questions.
(Use the student sample as a guide on format only. It does not include the full content required for the activity.)
Reflection Questions
Summarize the physical and chemical properties of the element you selected.
In the lesson, many models were used to depict the atom. How did these models help you understand atomic structure?
How do protons, neutrons, and electrons differ in terms of their electrical charges and locations within the atom?
Describe the four fundamental forces. Which of these forces are involved in chemical bonding?

Answers

Answer:

Protons neutrons and electrons

Answer:

can you add something like that about neon

Explanation:

please i need a good grade

the art of cave dwellers was crude and ____

Answers

Answer:

Because I searched this question up on Google, the only answer i can come up with is "Crude and mimetic" I really hope this helps!

The Latin prefix ad- means "toward," and the root jour comes from the French, meaning "day." The Latin suffix -ment turns a word into a noun, and has to do with an action or a process. Based on this knowledge of roots and affixes, write your definition of adjournment as it is used in the text, and tell how you got it. Use a dictionary to check its precise meaning.

Answers

Answer:

Adjournment - discontinue or suspend

Explanation:

The word 'adjournment' means suspending the meeting or court sitting for the day and to resume some other time. It is precisely used to denote that the meeting is discontinued for the for and will take place at some other time.

The word 'adjournment' has three syllable. 'Ad' which is the prefix, meaning "towards". The there is the second syllable 'jour' meaning "day". And the third part is the suffix, 'ment', which turn the word into a noun.

Thus, 'ad-journ-ment' means to suspend the meeting for the day.

Pls help dOnT have much time I’ll give brainliest I need help really bad

Answers

Answer:

Counterclaim is B: “meat based ... can be expensive.”

Explanation:

I can’t really see the pictures

Which of the following sentences is punctuated correctly?
OA. Geologists from all over the world travel to study the ancient, geyser.
B. The geyser sprayed a mist of warm, glittering water into the desert air.
C. Throughout the year, the geyser draws large, tour groups to its location.
OD. Every few hours, hot water is spurted from the mouth, of the geyser.

Answers

Answer:

B

Explanation:

the others have too many or too little punctuation. read the sentences and pause when there is a comma. Most of the time, if that pause makes sense then it is correct. For instance it makes no sense in D for there to be a comma after the word mouth. and In A it makes no sense to have one between the words ancient and geyser. Hope this helps :)

help? photo is attached. I'll mark brainliest

Answers

Answer: It’s A

Over 300 passengers were on the train

Answer: The first one.

Explanation: Because its the only one that makes sense.

The following is an example of what?

The sun shines in the sky - A

It shines so very high - A
rhyme scheme
meter
iambic pentameter
elegy

Answers

Answer:

rhyme scheme.

Explanation:

The given lines are an example of rhyme scheme.

A rhyme scheme can be defined as the sound at the end of each verse in a poem. This is a repetitive sound that occurs at the end of each verse in a song or poem. There are various types of rhyme schemes in literature such as internal rhyme, slant rhyme, etc.

In the given lines, the end of each verse rhyme with each other, that is sky and high. Therefore, the correct answer is option A.

I awoke to a thunderous sound in the middle of the night and sat up as straight as a board. I climbed slowly out of bed surrounded by a curtain of darkness. Usually, my nightlight would provide some sort of visual path for my eyes, but not this time. I stumbled as blind as a bat down the hall to my parent's room. I knocked my knuckles on their door and heard my dad's deep voice answer through the closed door. I told him about the sound I had heard and that my nightlight was not working. Opening the door, he said the electricity probably went out and that it would probably be back on in the morning. Because I was a scared rabbit, he let me climb into bed with him and Mom until morning. Tucked tightly under the covers between Mom and Dad, I felt as safe as a turtle hiding in its shell. Because I was a scared rabbit, he let me climb into bed with him and Mom. Based on the context, what does the sentence tell the reader about the dad? A. He probably has not slept much. B. He is a sympathetic person. C. He is also scared of the dark also. D. He enjoys helping small animals.

Answers

Answer: B

Explanation: he cares that his son was scared

Ayye its Drippqueen. i got the bars. We all know rappin is not really hard.

In class we had to write a rap and tell what the rhyme scheme is. I dont know what a rhyme scheme is. Can you define what a rhyme scheme is and tell me what the rhyme scheme of my rap is please?

Answers

Answer:

Swear to god not tryin to get free pts but i fr don't see nun

Explanation:

Answer:

okay a rhyme scheme is something like aabbcc

your rap is ababc, let me give u an example

apples are tasty

but im really lazy

i was talking to much

so she told me to start walking

that right there is aabb

Explanation:

3. If you are to assess whatever decisions you made in the past 2 months,
where do you categorize them and why?

Answers

Answer:

I decided to take a few days from work and I went to the countryside. This is a non-programmed decision because it is something I do not usually do.

I started the gym. This is a strategic decision because there's a long term purpuse.

I bought an espresso machine. This is a personal decision because it is just for my own benefit and pleasure.

Explanation:

To complete this exercise, you have to write about decisions you made and categorize them. When you research about decision making, all the categories are related to organization's decision making. However, those categorizations can also be used when talking about personal life's decisions as I did in the answer.

The above question requires a personal answer and for that reason, I cannot write an answer for you, but I will show you how to write it.

To answer this question, you need to reflect on the decisions you made, the criteria used to reach that decision, and the outcomes that were triggered.

During this reflection, you should be able to identify whether decisions were made wisely, emotionally, rationally, or impulsively.

Based on this, describe the characteristics of your decisions, labeling them according to those characteristics.

More information:

https://brainly.com/question/24708658?referrer=searchResults

analyze the main ideas supporting details presented in diverse media and formats. one of the main ideas presented in "learning to love my mother" is that love can heal a broken relationship. watch the video again, and then identify which details from the interview support this main idea answers

Answers

Answer:

Explanation:

One of the main ideas presented in “Learning to Love My Mother” is that love can heal a broken relationship

Will give brainliest!
This is from the short story “Doll House”
(a) Identify two reasons to explain why the doll’s house is initially kept outside.
(b) Connect What does the decision to keep the house outside allow the girls to do that they might not have done otherwise?
Use one piece of evidence

Answers

Answer:

1  the dollhouse smells like paint 2- They want to show it off.

Explanation:

They are able to invite friends to come see it.

HELP ME DUE in 3 MINS

Answers

Answer:

c

Explanation:

it shows the author is trying to persuade the reader

Each one in one Sentence about this words in
collective nouns
Class
Herd
Jury
Army
Council
Group
Family
Audience
Pack
Flock

Answers

THE ANSWER IS ARMY
THANKS HOPE THE ANSWER IS RIGHT

When Romeo declares his love for Juliet in the balcony scene, who hears it?

Answers

Answer:

God does....sorry trying to be funny.

Explanation:

Rosalind did

Answer:

Explanation:

Romeo has heard everything Juliet has said. His only problem (at the beginning) is if he should speak.

When he does, only Juliet hears what he has to say. No one else hears anything.


From the information in the paragraph, what can the reader infer about the basis for the current generation's interpretation
of Lincoln?
O A
Lincoln reflects the set of values and principles revered by the current culture.
Lincoln is regarded in the historical context of the time he served as president.
B.
The current culture supports a critical view of the political principles that Lincoln presented.
The current culture has a sentimental view of the historical figure of Lincoln

Answers

PLATO: The set of choices:

A. The current culture has a sentimental view of the historical figure of Lincoln.

B. Lincoln reflects the set of values and principles revered by the current culture.

C. Lincoln is regarded in the historical context of the time he served as president.

D. The current culture supports a critical view of the political principles that Lincoln presented.

The answer is B. Lincoln reflects the set of values and principles revered by the current culture.

Choose the answer that best completes the sentence. ______ war efforts increased the need for production, the US government started a poster campaign to motivate workers to work harder and produce more.


A.Therefore

B.However


C.Because



D.But

Answers

Answer:

I think this is right

c

Explanation:

Answer:

answer is c

Explanation:

PLEASE HELP I CANT FIGURE THIS OUT

when the group of men arrived, atticus confirms that tom robinson is inside the jailhouse sleeping and tells the men not to awaken him. scout reports "in obedience to my father, there followed what I later realized was sickeningly comic aspect of an unfunny situation: the men talking in near whispers." what is "sickeningly comic" about the situation? why is it ironic that the men agree to talk in whispers?

(chapter 15 of To Kill a MockingBird)

Answers

In Chapter 15 of To Kill a Mockingbird, Scout, Jem, and Dill venture downtown at night and find Atticus sitting in front of the jail. Unaware of their presence, Atticus is sitting in a chair and reading a newspaper. As the children begin to leave, a line of cars approaches and stops in front of the jail. Hiding near the hardware store, Scout, Jem, and Dill watch as the men exit the cars and approach Atticus. One of the men says, "He in there, Mr. Finch?" Atticus confirms that Tom Robinson is indeed inside but cautions them, "He's asleep. Don't wake him up." What follows is what Scout refers to as a "sickeningly comic aspect of an unfunny situation."
The men are there to participate in a violent and uncivilized act. However, while their goal is to lynch Tom, they are respectful of Atticus and do as he says by whispering when they speak. It is ironic that they plan to hurt Tom and may even hurt Atticus in the process; they speak to him respectfully and whisper out of obedience to him. They even refer to Atticus as "Mr. Finch." Though there is nothing funny about the events, Scout refers to the situation as "sickeningly comic." This is because the men are managing to be respectful while at the same time planning to do bodily harm.

I hope that helped :)

Which details from the text support the inference that Miss Emilie thinks lily should be working harder but Lily's mother does not? Select two opinions

Answers

Answer:

c and d

Explanation:

got a 96 percent

"Lily, sweetheart, I am worried that you are working much too hard for this audition," her mother said. "I wish you would find some perspective and realize that ballet is not the most important thing in the world." and  "Mom, how could you say that to me? I have been working for ten years for this," Lily said, impervious to her mother's words, are the details from the text support the inference that Miss Emilie thinks lily should be working harder but Lily's mother does not. Hence, option C and D are correct.

What is the concept of the passage?

The textual evidence demonstrates Miss Emilie's belief that Lily should put in extra effort while her mother does not. Miss Emilie tapped her foot impatiently, "I had anticipated you would have been here straight from school since we only have a few days to prepare for your audition."

Thus, option C and D are correct.

For more details about concept of the passage, click here:

https://brainly.com/question/20114697

#SPJ6

The options are missing from the question-

A) "I had assumed you would have come here straight from school since we only have a few days to prepare for your audition," Miss Emilie said, tapping her foot impatiently.

B) After a backbreaking practice that day and equally challenging rehearsals for several days after that, Lily returned home completely exhausted the night before her audition.

C) "Lily, sweetheart, I am worried that you are working much too hard for this audition," her mother said. "I wish you would find some perspective and realize that ballet is not the most important thing in the world."

D) "Mom, how could you say that to me? I have been working for ten years for this," Lily said, impervious to her mother's words.

E) ...she looked out at the adoring faces of her parents and Kip watching with unconditional love and support from their seats. She glanced over at the serious but endlessly dedicated face of Miss Emilie simultaneously watching her from backstage.

The most painful thing is losing yourself in the process of loving someone too much

Answers

Just know your worth and if there not showing the love back move on.

Anxiety is an _________________, feeling of dread much like fear . (fill in the blank)

Answers

Answer:

Emotional is the Answer

Explanation:

Answer:

Intense maybe?

Explanation:

I'm not sure, it would be easier if there were options but that is my best guess

Please answer these a best as possible!!!!!!


Easy Riddles
1. Riddle: What has to be broken before you can use it?


2. Riddle: I’m tall when I’m young, and I’m short when I’m old. What am I?


3. Riddle: What month of the year has 28 days?

4. Riddle: What is full of holes but still holds water?


5. Riddle: What question can you never answer yes to?


6. Riddle: What is always in front of you but can’t be seen?


7. Riddle: There’s a one-story house in which everything is yellow. Yellow walls, yellow doors, yellow furniture. What color are the stairs?


8. Riddle. What can you break, even if you never pick it up or touch it?


9. Riddle: What goes up but never comes down?


10. Riddle: A man who was outside in the rain without an umbrella or hat didn’t get a single hair on his head wet. Why?

11. Riddle: What gets wet while drying?


12. Riddle: What can you keep after giving to someone?


13. Riddle: I shave every day, but my beard stays the same. What am I?


14. Riddle: You see a boat filled with people, yet there isn’t a single person on board. How is that possible?


15. Riddle: You walk into a room that contains a match, a kerosene lamp, a candle and a fireplace. What would you light first?


16. Riddle: A man dies of old age on his 25 birthday. How is this possible?


17. Riddle: I have branches, but no fruit, trunk or leaves. What am I?

18. Riddle: What can’t talk but will reply when spoken to?


19. Riddle: The more of this there is, the less you see. What is it?


Riddles for Kids
20. Riddle: David’s parents have three sons: Snap, Crackle, and what’s the name of the third son?

Answers

Answer:

1.an egg

2.a candle

3.every month

4.a sponge

5.are u asleep? or are u dead?

6.the future

7.there are no stairs , it is a one story house

8.a promise

9.your age

10.he was bald.

11.a towel

12.your word

13.a barber

14.they are all married or taken

15.the match

16.he was born on a leap day ( feb 29th)

17.a bank or a large company

18.an echo

19.fog or darkness

20.david

hope it helps

if u have any question pls ask in comments

Egg

A candle

All 12 months

A sponge

Are you asleep?

The future?

It’s a one story house. No stairs

A promise

Age?

He was bald

Towel

Your word

A barber

Everyone is married

The match?

Born on a Leap year. Feb 29th

Government branches.

Breath. Or a bird

Darkness

David

Alonso read the underlined metaphor in the following
passage from a narrative text:
“As the two friends crept across the grass, branches from
the low-hanging trees grabbed at their arms. The wind
sighed in the treetops, and high overhead, the moon was a
pale fingernail."
How should Alonso explain the impact of the metaphor on
the tone of the text?

Answers

Answer:

D, I believe it is.

Explanation:

It makes sense to be the correct answer to highlight the livelyness of the environment.

Answer:

d !

Explanation: i hope this helps i just took the quiz !

What page in Fahrenheit 451 is the word “ravenous”on?

Answers

Answer:

Very Hungry page 41

Explanation:

:)

Answer:

p. 38-39

Explanation:

His hands were ravenous. And his eyes were beginning to feel hunger, as if they must look at something, anything, everything.

p. 38-39

ravenous = extremely hungry

the pros and cons of going to college. Would it benefit you or not?

Answers

Answer:

pro - get a better look at good jobs just bc of a piece of paper

con - loans and fines for years to pay off unless you get the millitary to pay for your collage

pro- get one of the highest educations you can

con - go to tech school make just as good of money but less loans to pay off

if you come from a poor family like me and want to go to collage go to the navy army  or somthing like that they will pay for your collage and you get a check for the rest of your life and hey who knows that might be the carrer you want to pruse once u get in there

Will mark brainliest and give 100 points!!

Which sentence is written in first-person point of view?

Her friends cheered as she scored the winning goal.
My friends cheered as I scored the winning goal.
Rita's friends cheered as she scored the winning goal.
Your friends cheered as you scored the winning goal.

Which sentence is written in third-person point of view?

Once a small crowd of protesters, we were now an angry mob.
Our small crowd of protesters was now an angry mob.
The small crowd of protesters had turned into an angry mob.
Your small crowd of protesters has now become an angry mob.

Answers

Answer:

First-person point of view: My friends cheered as I scored the winning goal.

Third-person point of view: The small crowd of protesters was now an angry mob.

Explanation:

Other Questions
Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, The scale on a map says that 4 cm represents 5 km. What distance on the map (in centimeters) represents an actual distance of 4 km? A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? What are some real-life situations that require a program that is iterative? Include at least three examples in your answer. Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope. 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs.