How long would it take a train traveling at 18 m/s to travel 7,500 m? Answer in minutes.

Please I need help !!

Answers

Answer 1

Answer:

6.94446 min

Explanation:

t=s/v


Related Questions

An unknown radioactive sample is observed to decrease in activity by a factor of two in a one hour period. What is its half-life?

Answers

Answer:

The half-life is [tex] t_{1/2} = 1.005 h[/tex]

Explanation:

Using the decay equation we have:

[tex]A=A_{0}e^{-\lambda t}[/tex]

Where:

λ is the decay constantA(0) the initial activityA is the activity at time t

We know the activity decrease by a factor of two in a one hour period (t = 1 h), it means that [tex]A = \frac{A_{0}}{2}[/tex]

[tex]\frac{A_{0}}{2}=A_{0}e^{-\lambda*1 h}[/tex]

[tex]0.5=e^{-\lambda*1 h}[/tex]

Taking the natural logarithm on each side we have:

[tex]ln(0.5)=-\lambda[/tex]

[tex]\lambda=0.69 h^{-1}[/tex]

Now, the relationship between the decay constant λ and the half-life t(1/2) is:

[tex]\lambda = \frac{ln(2)}{t_{1/2}}[/tex]

[tex] t_{1/2} = \frac{ln(2)}{\lambda}[/tex]

[tex] t_{1/2} = \frac{ln(2)}{0.69}[/tex]

[tex] t_{1/2} = 1.005 h[/tex]

I hope it helps you!

A 20 kg wagon is rolling to the right across a floor. A person attempts to catch and stop the crate and applies a force of 70 N, 180.0 on it. If the coefficient of friction is 0.18, calculate the deceleration rate of the wagon as it is caught.

Answers

Answer:

1.736m/s²

Explanation:

According to Newton's second law;

[tex]\sum F_x = ma_x\\[/tex]

[tex]Fm - Ff = ma_x\\[/tex] where;

Fm is the moving force = 70.0N

Ff is the frictional force acting on the body

[tex]Ff = \mu R\\Ff = \mu mg\\[/tex]

[tex]\mu[/tex] is the coefficient of friction

m is the mass of the object

g is the acceleration due to gravity

a is the acceleration/deceleration

The equation becomes;

[tex]Fm - Ff = ma_x\\Fm - \mu mg = ma\\[/tex]

Substitute the given parameters

[tex]Fm - \mu mg = ma\\70 - 0.18(20)(9.8) = 20a\\70-35.28 = 20a\\34.72 = 20a\\a = \frac{34.72}{20}\\a = 1.736m/s^2\\[/tex]

Hence the deceleration rate of the wagon as it is caught is 1.736m/s²

which of the following to all food chains depend on in an ecosystem

Answers

Answer:

The sun is the ultimate source of energy for all food chains. Through the process of photosynthesis, plants use light energy from the sun to make food energy. Energy flows, or is transferred through the system as one organism consumes another.

There is a bell at the top of a tower that is 45 m high. The bell weighs 190 N. The bell has ____________
energy.

Answers

Answer:

The bell has a potential energy of 8550 [J]

Explanation:

Since the belt is 45 [m] above ground level, only potential energy is available. And this energy can be calculated by means of the following equation.

[tex]E_{p}= W*h\\E_{p} = 190*45\\E_{p}=8550[J][/tex]

An element or compound used to enhance a semiconductor is called a(n) ____.

Answers

What ^ he/she said !.!.!

Hope you guys have a good day! And, Merry Christmas!

Be/stay safe, and enjoy your break!

The element named boron can be used to enhance the properties of semiconductors.

What is a semiconductor?

A semiconductor is a material that has electronic properties and has the value that falls in between a conductor. It can be a metallic copper or an insulator.

The rise in temperatures leads to a fall in resistivity. The element named boron can improve the electrical properties of the semiconductor as they form the impurities.

Find out more information about the element.

brainly.com/question/12389810

The force of gravity between any two ordinary objects on the earth is.......
A) stronger when closer to the earth
B) stronger if the objects are closer to each other C) always downward
D) stronger than the force of gravity from the earth​

Answers

Answer:

c

Explanation: beacuse newtons law of phisics says ''what goes up must come down''

The force of gravity between any two ordinary objects on the earth is stronger if the objects are closer to each other.

The force of gravity between two object on the earth surface is given Newton's law of universal gravitation;

[tex]F= \frac{Gm_1m_2}{r^2}[/tex]

where;

G is gravitational constantm₁ and m₂ are the masses of the two objectsr is the distance between the two objects

The distance between the object is inversely proportional to the force of gravity between the objects. The smaller the distance between the two objects, the greater the force of gravity and vice versa.

Thus, we can conclude that the force of gravity between any two ordinary objects on the earth is stronger if the objects are closer to each other.

Learn more here:https://brainly.com/question/10609143

What is the algebraic sign (+ or -) for designating the distance and velocity vectors for an object in free fall?

Answers

Answer:

positive- downward

negative- upward

Explanation:

A vector is a quantity described by a magnitude and a direction.

The algebraic sign, positive (+) and negative (-) are used to designate the distance and velocity vectors for an object in free fall where positive represents downward  and negative represents an upward movement of the object.

Hence, the correct answer is "positive- downward  and negative- upward".

A 80 kg parent and a 20 kg child meet at the center of an ice rink. They place their hands together and push. The parent pushes the child with a force of 25 N, what is the force acting on the parent?

Answers

Answer:

force acting on the parent = 25 N .

Explanation:

According to third law of Newton , there is equal and opposite reaction to every action . Here force by the parent on child is action and the force by child on parent is reaction . The former is given as 25 N so force by child on parent will also be 25 N .

Answer is 25 N .

convert 100 Newton into dyne​

Answers

Answer:10000000

Explanation:

It would actually be 10 million dyne

If the magnitude of the electric field of an electromagnetic wave is 3x10^3 V/m, what is the the magntude of the magnetic field?
a. 1.1 x 10^-12 T
b. 9 x 10^11 T
c. 10^5 T
d. 10^-5 T
e. 3 x 10^3 T

Answers

Answer:

The value of the  magnetic field is [tex]B = 1.0*10^{-5} \ T[/tex]

The correct option is d

Explanation:

From the question we are told that  

    The magnitude of the electric field is  [tex]E = 3*10^{3} \ V/m[/tex]

     Generally the magnitude of  the magnetic field is mathematically represented as

        [tex]B = \frac{E}{c}[/tex]

Here  c is the speed of  light [tex]c = 3.0*10^{8} \ m/s[/tex]

=>     [tex]B = \frac{E}{c}[/tex]

=>      [tex]B = \frac{3.0*10^{3}}{ 3.0*10^{8}}[/tex]

=>      [tex]B = 1.0*10^{-5} \ T[/tex]

A circuit component that is a composed of a semiconductor layer sandwiched between two other semiconductor layers is a(n)?

Answers

Explanation:

It's a transistor. Hope that helps!

Answer:

D. Transistor

Explanation:

Edge 2021

How was the Periodic Table of Elements developed and how are the elements arranged on it?

Answers

Answer:

In 1869 Russian chemist Dimitri Mendeleev started the development of the periodic table, arranging chemical elements by atomic mass. He predicted the discovery of other elements, and left spaces open in his periodic table for them.

Explanation:

Answer: Mendeleev first published a table of elements arranged according to increasing atomic masses. He noticed that some elements near each other had differing properties, but elements in vertical columns had similar properties. Moseley then rearranged the table according to atomic numbers and this eliminated the discrepancies found in Mendeleev’s attempt. Today’s version of the periodic table displays elements in order based on their atomic number; the atomic number indicates the number of protons within the atoms of a particular element. Rows are called periods and columns are called groups. Elements in the same group have similar properties. Elements are grouped into nine categories: noble gases, halogens, nonmetals, alkali metals, alkaline earth metals, transition metals, other metals, metalloids, and rare earth elements.

An object with a mass of 32 kg has an initial energy of 500). At the end of the experimentthe velocity of the object is recorded as 5.1 m/s . the object travelled 50 m to get to this point, what was the average force of friction on object during the tripAssume no potential energy Show all work

Answers

Answer:

 F = 1.68 N

Explanation:

Let's solve this exercise in parts.

Let's use the concept of conservation of the mechanical nerve

initial

    Em₀ = 500 J

The energy is totally kinetic

     Em₀ = K = ½ m v₀²

     v₀ = [tex]\sqrt{\frac{2 Em_{o} }{m} }[/tex]

     v₀ = √ (2 500/32)

     v₀ = 5.59 m / s

now with kinematics we can find a space

      v² = v₀² - 2 a x

the negative sign is because the body is stopping

       a =[tex]( \frac{v_{o}^{2} - v^{2} }{2x} )[/tex]  

let's calculate

       a = (5.59² - 5.1²) / 2 50  

       a = 0.0524 m / s²

Finally let's use Newton's second law

     F = ma

     F = 32 0.0524

     F = 1.68 N

Collision Lab
This activity will help you meet these educational goals:

You will explain or predict phenomena by exploring qualitative relationships between variables.
You will use positive and negative numbers to represent quantities in real-world contexts.
Directions
Read the instructions for this self-checked activity. Type in your response to each question, and check your answers. At the end of the activity, write a brief evaluation of your work.
Activity
Open this collision simulator and click Introduction. You’ll use the simulator to explore and compare elastic collisions and inelastic collisions. The mass and starting velocity of the colliding objects are kept constant. Follow the instructions in each part, and then answer the questions that follow. Use the math review if you need help with adding and subtracting negative numbers.

Question 1: Elastic Collisions
In this question, you will investigate elastic (bouncy) collisions. Be sure that the slider is to the extreme right (elasticity 100%).

Part A
Click Show Values in the upper-right corner. Study the boxes on the screen. What are the mass and initial velocity of ball 1 and ball 2?

I NEED HELP!


Part B
Part B
Click Play, and watch the balls collide. Then click Pause. What are the final velocities of ball 1 and ball 2?


The number line shows the starting and ending velocities for ball 1. What’s the change in velocity of ball 1? Calculate the value mathematically, and check it using the number line.

a number line showing an ending velocity of -0.50 meter/second and a starting velocity of 1.00 meter/second

Answers

Answer:

Ball 1 has a mass of 0.5 kilogram and an initial velocity of 1.00 meter/second. Ball 2 has a mass of 1.5 kg and an initial velocity of 0.00 meters/second.

Explanation:

Ball 1 has a mass of 0.5 kilogram and an initial velocity of 1.00 meter/second. Ball 2 has a mass of 1.5 kg and an initial velocity of 0.00 meters/second.

What is Collision?

A collision is any situation in which two or more bodies quickly exert forces on one another. Despite the fact that the most common usage of the word "collision" refers to situations in which two or more objects clash violently, the scientific usage of the word makes no such assumptions.

The following are a few instances of physical encounters that scientists might classify as collisions. Legs of an insect are said to collide with a leaf when it falls on one.

Every contact of a cat's paws with the ground while it strides across a lawn is seen as a collision, as is every brush of its fur with a blade of grass.

Therefore, Ball 1 has a mass of 0.5 kilogram and an initial velocity of 1.00 meter/second. Ball 2 has a mass of 1.5 kg and an initial velocity of 0.00 meters/second.

To learn more about collision, refer to the link:

https://brainly.com/question/13138178

#SPJ2

find the base area of a cylinder with diameter 1m​

Answers

Answer:

AB=0.79

Explanation:

hope this helped

Which of the following is not an example of work being done on an object?

Pushing on a rock that will not move

Paddeling a canoe down a river

Lifting a bag of groceries

Throwing a ball across a field​

Answers

Answer:

Lifting a bag of groceries

Answer:

paddeling a canoe down a river :D or throwing a ball across a field

Explanation:

A 65-cm segment of conducting wire carries a current of 0.35 A. The wire is placed in a uniform magnetic field that has a magnitude of 1.24 T. What is the angle between the wire segment and the magnetic field if the force on the wire is 0.26 N?
a. 37°.
b. 43°.
c. 23°.
d. 53°.
e. 67°.

Answers

Answer:

e) 67°

Explanation:

the force on the wire can be calculated using the expression below

F = BILsinФ

But we are looking for the angle between the wire segment and the magnetic field, then we can make Ф the subject of the formula from the above expresion, then we have,

Ф =sin⁻¹ (F/BIL)

The parameters is defined as

I =current that is been carried by the wire= 0.35 A

Ф = angle between the wire segment and the magnetic field, which is the unknown?

L = length of the wire=65 cm

B = magnetic field = 1.24

F= force on the wire = 0.26 N,

Ф =sin⁻¹ (F/BIL)

Ф =sin⁻¹ X .....................eqn(#)

Where X= (F/BIL)

We can calculate for X= (F/BIL), from eqn(#) by substituting value of Force, Lenght and

magnetic field

X=(F/BIL)= 0.26/(1.24×0.35×0.65)

= 0.26/0.2821

=0.922

Then substitute X into eqn (Ф =sin⁻¹ X)

Then

Ф =sin⁻¹ (0.922)

Ф=66.42°

Ф=67° approximately

Therefore, the angle between the wire segment and the magnetic field is 67°

What is the acceleration of the the object during the first 4 seconds?

Answers

Answer:

Velocity (m/s) over time (s) graph

Velocity (m/s) over time (s) graph

We could write out our average acceleration as:

a = Δv/ Δta=Δv/Δta, equals, Δ, v, slash, Δ, t

a = (15 m/s - 0 m/s) / 0.2 seconds

a = 15 m/s / 0.2 seconds

a = 75 m/s / second

Explanation:

What this formula is telling us is that if we know the acceleration of an object, and the ... we can plug in our acceleration of 12.5 m/s2 for a, and 4 seconds for t.

Velocity (m/s) over time (s) graph

Velocity (m/s) over time (s) graph

We could write out our average acceleration as:

a = Δv/ Δta=Δv/Δta, equals, Δ, v, slash, Δ, t

a = (15 m/s - 0 m/s) / 0.2 seconds

a = 15 m/s / 0.2 seconds

a = 75 m/s / second

which energy resource is renewable
A. oil
B. natural gas
C. moving water
D. Fossil fuel

Answers

Answer:

It's C. Moving Waterrrr

It’s C moving water. Oil, natural gas, and fossil fuels are non-renewable.

on the moon which object would fall with the same acceleration?

Answers

Answer:

Since there is no air resistance on the Moon, all objects would be in free fall at 1.6 m/s2. This means that they would all hit the ground at the same time if released simultaneously from the same height, but at a slower speed compared to objects free falling in a vacuum on Earth.

Explanation:

The fact that our preconceived ideas contribute to our ability to process new information best illustrates the importance of: the serial position effect. O repression iconic memory . semantic encoding . retroactive interference .

Answers

Answer:

It’s a

Explanation:

Don’t actually put that i needed the points mb

A projectile is fired horizontally from a height of 10 m above level ground. The projectile lands a horizontal distance of 15 m from where it was launched.
-Find the hang time for the projectile.
-Find the initial speed of a projectile.
-What are the x and y components of the projectile’s velocity the moment before it strikes the ground?
-At what speed will the projectile strike the ground?

Answers

Answer:

a)t  = 1,43 s

b) V = 10,49 m/s

c) V₀ₓ = 10,49 m/s   ;    V₀y = 14,01 m/s

d) Vf = 17,5 m/s

Explanation:

According to the problem statement

V₀ = V₀ₓ    and  V₀y = 0

And at the end of the movement t = ?  the distance y = 10 m

Therefore as

h = V₀y - (1/2)*g*t²

Vertical distance y = h = 10 = V₀y*t - 0,5 (-9,8)*t²

10 = 4,9*t²

t² = 10/4,9    ⇒  t² = 2,04 s

t  = 1,43 s

a) 1,43 s is the time of movement

b) V₀ = V₀ₓ        V₀y = 0     and  V₀ₓ = Vₓ     ( constant )

Just before touching the ground, the horizontal distance is

hd = 15 = Vₓ * t

Then  15 /1,43 = Vₓ = V₀ₓ

Vₓ = 10,49 m/s

Then initial speed is V = 10,49 m/s    since V₀y = 0

Vf² = Vₓ² + Vy²

Vyf = V₀y - g*t

Vyf =  0 - 9,8 *1,43

Vyf = - 14,01 m/s

And finally the speed when the projectile strike the ground is:

Vf² = Vₓ² + Vy²

Vf = √ (10,49)² + (14,01)²

Vf = 17,50 m/s

At the instant its angular displacement is 0.32 rad, the angular acceleration of a physical pendulum is -630 rad/s2. What is its angular frequency of oscillation?
6.6 rad/s
14 rad/s
20 rad/s
44 rad/s
200 rad/s

Answers

Answer:

200rad/s

Explanation:

The angular frequency of oscillation of the pendulum is 44.3 rad/s.

What is meant by angular frequency ?

Angular frequency is defined as the rate of change of angular displacement in a simple harmonic motion.

Here,

Angular displacement of the pendulum, θ = 0.32 rad

Angular acceleration, α = -630 rad/s²

We know that the equation for angular acceleration is given by,

α = -ω²θ

where ω is the angular frequency

ω² = -α/θ

ω² = 630/0.32

ω² = 1968.8

Therefore,

Angular frequency, ω = √1968.8

ω = 44.3 rad/s

Hence,

The angular frequency of oscillation of the pendulum is 44.3 rad/s.

To learn more about angular frequency, click:

https://brainly.com/question/14103673

#SPJ3

How much more efficient is organic farming than "regular" farming?

Answers

Answer:

Organic systems used 45% less energy overall than conventional systems. Production efficiency was 28% higher in the organic systems, with the conventional no-till system being the least efficient in terms of energy usage.

Answer: 65%

Explanation: i took the quiz

what is the potential energy of a 30kg rock that falls 15 meters

Answers

Answer:

4500 J

Explanation:

The potential energy of a body can be found by using the formula

PE = mgh

where

m is the mass

h is the height

g is the acceleration due to gravity which is 10 m/s²

From the question we have

PE = 30 × 10 × 15

We have the final answer as

4500 J

Hope this helps you

A rocket falls from the apogee (0 meters per second) until it hits the ground with a speed of 10 meters per second. Gravity pulled it down with an acceleration of 9.8m/s^2. The time during which the ball is in free fall is approximately what time?

Answers

Answer:

Approximately 1.02 seconds

Explanation:

Use the final velocity (vf) formula for a uniformly accelerated movement under "g" (acceleration of gravity):

[tex]v_f=v_i+g\,*\,t[/tex]

in our case:

[tex]10=0+9.8\,*\,t\\t=10/9.8\\t\approx 1.02\,\,sec[/tex]

Which is the largest gas that occurs in our atmosphere?
Helium
Nitrogen
Other Gases
Oxygen

Answers

Answer:

OXYGEN

Explanation:brainlyist me

Answer:

Nitrogen

Explanation:

Oxygen is second

Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A?

Answers

Answer:

The value is  [tex]p = 0.7556 c[/tex]

Explanation:

From the question we are told that

   The speed at which galaxy B moves away from galaxy A is  [tex]v = 0.577c[/tex]

Here c is the speed of light with value  [tex]c = 3.0 *10^{8} \ m/s[/tex]

     The speed at which galaxy C moves away from galaxy B is  [tex]u = 0.731 c[/tex]

Generally from the equation of  relative speed we have that  

     [tex]u = \frac{p - v}{ 1 - \frac{ p * v}{c^2} }[/tex]

Here p is the velocity at which galaxy C recede from galaxy A so

     [tex]0.731c = \frac{p - 0.577c }{ 1 - \frac{ p * 0.577c}{c^2} }[/tex]

=>   [tex]0.731c [1 - \frac{ p * 0.577}{c}] = p - 0.577c[/tex]

=>   [tex]0.731c - 0.4218 p = p - 0.577c[/tex]

=>   [tex]0.731c + 0.577c = p + 0.4218 p[/tex]

=>   [tex]1.308 c = 1.731 p[/tex]

=>    [tex]p = 0.7556 c[/tex]

A 60-kg jogger runs up a long flight of
stairs in 4.0 s. The vertical height of the
stairs is 4.5 m.
a. Estimate the jogger's power
output in watts and horsepower.
b. How much energy did this
require?

Answers

Explanation:

Given parameters:

Mass of Jogger  = 60kg

Time  = 4s

Vertical height  = 4.5m

Unknown:

Jogger's power output  = ?

Energy required  = ?

Solution:

The power output of the jogger is defined as the rate at which work is done.

 Power  = [tex]\frac{force x distance}{time}[/tex]  

Now insert the parameters and solve;

  Work done = Force x distance = mgh

   m is the mass

   g is the acceleration due to gravity = 9.8m/s²

    h is the height

  Work done  = 60 x 9.8 x 4.5  = 2646J

 Power = [tex]\frac{2646}{4}[/tex]   = 661.5W

Energy required;

 The work done here is also the energy required;

 Energy required  = 2646J

The energy required is 2646 J and the jogger's power output 661.5 W.

Given here,

Mass of Jogger  = 60 kg

Time  = 4s

Vertical height  = 4.5 m

The power output of the jogger is defined as the rate of energy tranfer  work is done.

Power  =  W/t

Where,

W- work = mgh = 60 kg  x  9.8 m/s² x 4.5 m = 2646 J

t - time - 4 s

Put the values, we get

Power = 661.5W

To know more about power,

https://brainly.com/question/8288959

Describe the motion of an object as it accelerates. IN YOUR OWN WORD!! ASAP

Answers

Answer:

The aceleration of an object is in the direction of the net force. If you push or pull an object in a particular direction, it accelerates in that direction. The aceleration has a magnitude directly proportional to the magnitude of the net force.

Explanation:

Hope this helps Plz mark brainliest

Other Questions
WILL MARK BRAINLIEST IF CORRECT PLEASE HELP!!Which graph represents this system?y = one-half x + 3. y = three-halves x minus 1A. On a coordinate plane, a line goes through (0, 3) and (4, 5) and another goes through (0, negative 1) and (2, 2).B. On a coordinate plane, a line goes through (0, 3) and (1, negative 3) and another goes through (0, negative 1) and (3, 1).C. On a coordinate plane, a line goes through (negative 1, negative 2) and (1, 4) and another goes through (0, 1.5) and (1.5, 0).D. On a coordinate plane, a line goes through (negative 3, negative 3) and (0, 3) and another goes through (0, negative 1) and (3, 1). I neeed help pleaseeee GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182 I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Who are the most aggressive of the types we looked at? what's the pagathorium theorem A power pole 10 m tall casts a shadow 8 meters long, at the same time that a building nearby casts a shadow 14 m long. How tall is the building? The movement of water in or out of the cell membrane without the use of ATP.Diffusion Facilitated diffusion OsmosisExcoytosis