how is chromosomal number maintained during second meiotic division of the secondary spermatocyte​

Answers

Answer 1
At the end of the first meiosis division. Each secondary spermatocyte would contain a total of 23 chromosomes

Each secondary spermatocyte completes the second meiotic division without the replication of DNA.

Primary spermatocyte have 46 double structured chromosomes

Secondary spermatocyte has 23 double structured chromosomes

It doubles

Related Questions

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

explain how water properties help get water from the roots of plants to leaves

Answers

Answer:

In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.

Explanation:

Help I need helpppppppoo

Answers

meters per second. distance is meters and time is seconds
meters per second I’m right

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

ALOT OF POINTS PLEASE HELP :)

How did humankind discover the presence of DNA?

Answers

Answer:

The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.

Explanation:

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

A botanist finds that when compared to pink flowers, the population of purple flowers is very high. Ten years later, the population of purple flowers is nearly gone, and the number of pink flowers has tripled. Why would this be?

Answers

Answer:

Because of the reduction or near extinction of the purple flowers noticed by the botanist Ten years after it was in abundance, this fall in the population could be caused by the unfavorable change in the plant's environment. While the pink flowers tripled because some factors in the environment were favorable for its growth.

Explanation:

From the question, it was mention that the botanist noticed at first purple flowers had more population than the pink flowers and that changed after 10 years when the population of the pink flowers tripled and purple flowers were nearly gone. Some of the causes that could be responsible are:

1. Disease and pest attack on the purple flowers.

2. The pink flowers developed a good survival mechanism even in adverse conditions.

3. Environmental stress could also come into play on the purple flowers.

4. Climate which initially supported the growth of the purple flowers had changed. Because variations exist in plants and the ideal conditions necessary for plant growths and proliferation varies among plants.

.

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

Whats the answer giving brainliest HELP!!!!!

Answers

Answer:

I feel like the first one is the best

Explanation:

widening the roads will just cause more cars.

raising the price is most likely not gonna help but its an option.

expanding just means more cars

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

which statement describes what happens to rocky shorelines that absorb energy from ocean waves?

Answers

Answer:

Solid rock break apart

Explanation:

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA
Other Questions
PLZ HELP IM BEGGING Please help me I will give you the brain thing and extra points.Two dogs are pulling a disk, but the disk is not moving. The disk does not move because the forces are (select one: unbalanced, balanced, in motion, at rest.) Can someone please help! Its just Area so it should be pretty simple but I am stuck please help! what does jefferson think the government should not do Please help me if you can HELPPP!!!!im not really good at math im coming for help pleaseeee!!!!pleaseee be kind and help there are 12 boys and 8 girls in the french club. 1) what is the ratio of boys to girls? A. 2:5B. 3:5C: 2:3D: 3:22) what percent of the members of the french group are girls?A) 8%B) 40%C) 60%D) 75% What did the crusaders believe would happened by taking part in the crusades? each unit requires 1.8 yd of fabric to be produced. at the end of each quarter, 20% of the next quarter's production needs for material should be at hand. budgeted purchases of material for the second quarter would be g What is the sum of (4s+3)+(2s+1) A sandbox is located at (-8, -3). How many UNITS apart on the coordinate plane are the locations of the swing set and the sandbox? The Mountain Spring Water Company is moving their backup supply of drinking water to a different site. Each tank weighs according the table shown here. Determine if the function is linear or not. bothneitherlinearnonlinear What is 2.75 times 8 Do earthquakes occur at convergent plate boundaries? Yes or no? True or False. Answer these 3 questions will give 30 points I need help really bad with this!!!For the following:Highlight each subscript in RED.Highlight each coefficient in BLUE.H2O 5Cl2 2Mg 3H2O2For the followingList the chemical symbols of each element.Give the number of atoms of each element.HCl CO2 Na2SO4Balance the following chemical equations.1. Cu2O + C Cu + CO22. H2O2 H2O + O2 Al + Fe3N2 AlN + Fe4. Ag2S Ag + S85. ZnS + AlP Zn3P2 + Al2S36. Fe(OH)3 Fe2O3 + H2OGiven the two chemical equations, highlight in RED the one that is balanced.7. a. 2Na + Cl2 2NaClb. 2Na + 2Cl2 2NaCl8. a. C3H8 + 5O2 3CO2 + 4H2O b. 2C3H8 + 5O2 3CO2 + 8H2O9. a. 2NH3 + 5O2 2NO + 3H2O b. 4NH3 + 5O2 4NO + 6H2O10. a. Y(NO3)2 + GaPO4 YPO4 + Ga(NO3)2b. 2Y(NO3)2 + 2GaPO4 2YPO4 + Ga(NO3)2 Find the percent increase from 15 to 18 Judah is unhappy with the color and exposure in some of his recent photographs.What might the RAW converter in his camera use to rectify this issue? What is a similarity and a difference between the stars Rigel & Betelgeuse? There are 2 genes that decide each of your traits, and those 2 genes are always exactly alike. True or false??