In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.
When animals die, their bodies degrade into the soil, encasing the carbon in layers that eventually transform into rock or minerals. hence option b is correct.
What is rock?Stone including limestone and its minerals is created when sediment and shell layers are bonded together over time.
Gases like carbon dioxide are among the forms of carbon that are stored in the atmosphere. Animals that consume the plants can then absorb and store this carbon.
When animals die, their bodies degrade into silt, encasing the carbon in layers that eventually transform into rock or minerals. Some of this silt may eventually turn into fossil fuels like coal, oil, or natural gas, which when burned, release carbon back into the atmosphere.
Therefore, when an animal dies to decompose into the soil which becomes rocks through carbon from living organisms moves into rocks, hence option b is correct.
Learn more about rocks, here:
https://brainly.com/question/23464190
#SPJ2
Why are there not many vaccines for fungal & parasite disease as we have for viral and bacterial disease?
Answer:
it is very easy to kill the pathogen by vaccination but it is very difficult to detoxify the toxins produced in the host.
Explanation:
Hopefully this helped!
The __________________ is the tunnel that cuts through the external auditory meatus delivering sound to the ear drum or the _____________________.
Answer:
The auricle (pinna) is the visible portion of the outer ear. It collects sound waves and channels them into the ear canal (external auditory meatus), where the sound is amplified. The sound waves then travel toward a flexible, oval membrane at the end of the ear canal called the eardrum, or tympanic membrane.
Explanation:
A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of
Answer:
Convergence
Explanation:
The hummingbird is more closely related to a lizard than it is to a dragonfly. Explain why two species that look similar are not necessarily closely related.
Answer the following qs :
1- Mention three uses or benefits of fungi ?
Answer:
Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.
Explanation:
Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.
What does fat become after the chemical process?
Answer:
uR mOtHeR
Explanation:
dUnno im sorry and very bored
In which of these does a chemical change take place?
mixture
compound
solution
none of the above
Define bottleneck effect.
Koyi hai? ✌️
Answer:
When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.Hope this helps ~Answer:
The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.
Which of the following statements is FALSE?
Answer:
I'll wait for some possible answers...
Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock
Answer:
I suppose the answer is C
Each layer of a soil profile best describes a soil horizon.
What is a soil horizon?A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.
Some common soil horizons include the surface horizon, the subsoil, and the parent material.
Learn more about soil horizon, here:
https://brainly.com/question/2416348
#SPJ5
4. What is a function of the nucleus of an animal cell?
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
C. It defends the cell from infections.
D. It captures sunlight to produce food.
5. Select a statement that best completes the phrase below. In a plant
Answer:
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
Explanation:
2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur
Answer:
option a) is correct.
Explanation:
in IVF the fertilisation is always external.
Answer it correctly please
4. Explain the law of conservation of energy.
what is chloride shift
Most Americans/Canada say they hope to die __________.
i think they hope to die at home
1. What is the major source of energy for the brain
Explanation:
glucose
The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.
hope its helpful to you #
The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.
What is the brain?The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.
Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.
The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.
Thus, glucose is the major source of energy for the brain.
To learn more about energy, refer to the link:
https://brainly.com/question/781388
#SPJ2
How can carbon can be stored for a short time in the natural cycle?
Answer:
The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.
4. What is the molecule used by cells to store energy?
Answer:
What is the molecule used by cells to store energy?
Explanation:
Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.
Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced
Answer:
Glucose
Explanation:
Only glucose is produced in the light independent stage of the reaction
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas
Answer:
Nope
Explanation:
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
Nope
What are examples of devices that use electromagnetic waves? Check all that apply.
-FM radios
-microwaves
=TV remote controls
Answer:
FM radios and TV remote controls.
Describe the structure and function of areolar connective tissue.
Answer:
Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.
Why is it necessary for there to be variation in population in order for evolution by natural selection to occur?
Answer:
There needs to be variations in population in order for natural selection to occur because the entire point of evolution by natural selection is only the best variations will survive. So if there were no variations then there would be no natural selection because the animal's survival rate would be the same no matter how many times they reproduce because there are no different variations being introduced into the species. However, if there are variations then the animal's survival rate could be impacted because of the variations, for example, white mice would be easier to find for predators on a dark surface, while a darker mice would be harder to find for predators on a dark surface, thus, allowing the darker mice to prevail as they have a higher survival rate and the species will slowly evolve into the darker mice. But, if there were no evolution, in this case, then no matter what happens, the white mice would not be able to evolve into a darker mice because there are no such thing as variation. That is why it is necessary for there to be variation in order for evolution by natural selection to occur.
thrips are insects that feed on rose
Answer:
????????????????????????
which fungus does contain mycelium?
Answer:
Mycelium is part of the fungi kingdom and is the network of threads, called hyphae, from which mushrooms grow. Not all mycelia fruit mushrooms, depending on the environmental conditions, but all mushrooms come from mycelia.
Explanation:
explain how biodiversity affects ecosystem services.
Many livestock are being grazed on public lands because the fees to graze on public lands are cheaper than the fees for private lands. If we aren't careful, what can this cause? A. owners moving their livestock TO private lands B. increased fees for private lands C. overgrazing on public lands D. overgrazing on private lands
Answer:
I would say that this would cause "overgrazing on public lands."
Explanation:
When people see that the fees are cheaper, they would send their livestock there. It might be alot of livestock though
4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?
Answer:
They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.
As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.