Explanation:
To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.
If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?
Answer:you could ask your family or look it up you ar probably right next to a sadelite
so connection should be pretty good
I have a question.... my teacher today in biology said " you think you are moving your hand by yourself, but it's actually your brain sending commands to your muscles so they can move." So I wondered.. is my brain sending commands so I can think, or am I thinking whenever I have a desire to? (Not a trick question; My friend thinks this is a trick question lol).
Answer:
you are think of a command and your brain respond to you desire
Explanation:
how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet
Answer:
Due to no jaws, no paired fins and scales on the body.
Explanation:
Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.
Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?
The stomata of a desert cactus will close during the day.
STOMATA:
The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases. The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss. Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day. Therefore, the stomata of a desert cactus will close during the day.Learn more at: https://brainly.com/question/3387375?referrer=searchResults
What larger part of the body do cells make up?
Answer:
i pretty sure it ovum :)
Explanation:
70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.
Answer:
can I write an essay
Explanation:
On April 20, 1902, Marie and Curie with success isolate radioactive metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.
Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.
When do you think the rays of the sun encounter particles
Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY
Answer:
Freeze-thaw
Explanation:
Answer:
frost wedging
Explanation:
Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?
A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?
Answer: D. Can selection in nature also lead to a new species over time?
Explanation:
Answer:
Can selection in nature also lead to a new species over time?
Explanation:
Correct on edge 2021 hope this helps :)
why does the temp of the air increase with the height of the stratosphere?
Answer:
The hot air rises and the cool air falls
Explanation:
The process by which modern organisms have descended from ancient organisms
Answer:
evolution, or change over time
Explanation:
Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
Not a long life story but a simple two reasons.
Answer:
1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.
2-They also don't reproduce independently but must replicate by invading living cells.
What is Pedigree?? Can someone help me i need this answer plzzzzzz
Answer:
A pedigree is like a lineage or a recorded ancestry. For example, if a dog has recorded breeding papers it would show you it's pedigree. I hope that helped! :)
Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.
(This is 7th grade science).
like your name
Explanation:
Which of these are an important part of a scientific process?
Answer:
Is it multiple choice?? If it is, then show us the options
Explanation:
Which plant propagation process insures some genetic diversity?
Answer:
Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.
Explanation:
Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.
Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.
Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?
January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?
What causes antibiotic resistance?
- Only using antibiotics when you are also doing radiation therapy
- Only using antibiotics when you are also doing chemotherapy
- Any use of antibiotics causes resistance
- We do not know
Answer:
Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria.
your welcome ;)
Explanation:
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil
Answer:
B)Magma
Explanation:
In the light independent reaction _____, ______, and ______ combine to make ______ and ______
Answer/Explanation:
In the light independent reaction carbon dioxide, ATP, and NADPH combine to make glucose and oxygen.
Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens
All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.
The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.Hence, all of the statements correctly identify a lymphatic organ.
How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.To learn more about the Lymphatic System refer to:
https://brainly.com/question/13676212
#SPJ1
Which blood component fights and destroys disease-causing bacteria and
viruses?
Answer:
white cells
Explanation:
Which plant cell structures capture sunlight to produce sugars? a. vacuoles b. ribosomes c. mitochondria d. chloroplasts
Why are bananas curved?
Answer:
It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.
Explanation:
g.o.o.g.l.e lma o
Answer
It's because of the sun!
Explanation:
Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?
Answer:
Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.
Hope this helped!
Describe some of the reasons for exploring the mid-Cayman ridge.
Answer:
Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.
Explanation:
This was the answer on edge
The major reason for exploring the mid-Cayman ridge is to provide
information on what those life forms looked like.
What is Photosynthesis?This is the process in which plants manufacture their food in the presence
of sunlight and other compounds.
The mid-Cayman ridge which is present in a deep water environment has
lacks any source of light has some life-forms present. The exploration was
to find out the type of life forms present and how they appear.
Read more about Mid-cayman ridge here https://brainly.com/question/2747950
Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.
Answer:
a. The ability to cure genetic diseases by replacing defective genes
Explanation: