How did scientists begin to Mark divisions in the geologic time scale in response to a change they discovered in the geologic record

Answers

Answer 1

Answer:

Scientists began to mark division on the geologic time scale when patterns and similarities started emerging from archeological studies. Patterns such as the discovery of fossils that were formed within the same period.

Explanation:

Geologists who study matter that make up the Earth's crust (whether solid gaseous or liquid), as well as matter from other terrestrial planets and the processes that influence the formation and condition of this matter, are called geologists.

They have successfully calibrated history into various phases of time intervals. These intervals are event-based intervals. For example, you have Eons, Eras, and Periods.

An Eon is a billion years. An example is the Neoproterozoid Eon. Eons are made up of several Eras and Eras are made up of periods. An example of an era is the Mesozoic era. Whilst periods are smaller units of an era, eg. Triassic era.

As scientists deduced the causes for the formation of fossils and topographical remains/patterns, they collected events that occurred within the same time period and group them together.

This range of events became known as the geological time scale.

The age of fossils and rocks is also used to map out the calibrations on the scale.

The age of fossils and rocks is determined using the process of radioactive dating.

Cheers


Related Questions

Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'

Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle

column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism

Answers

Answer:

cell=ova

plant=organism

tissue=group of similar cells

nose=organ

organelle=nucleus

PLEASE HELP ASAP Match each word with the phrase that best defines it.
informal
a statement that is objective or unchanging
fact
done in a way that is friendly or casual
formal
a statement that is subjective or based on
interpretation
topic
done in a way that is suitable, appropriate,
or based on guidelines
opinion
the main point of a given subject

Answers

Answer:

fact: a statement that is objective or unchanging

informal: done in a way that is friendly or casual

formal: done in a way that is suitable, appropriate,

or based on guidelines

opinion: a statement that is subjective or based on

interpretation

topic: the main point of a given subject

Match each word with the phrase that best defines it.

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

What are Phrases?

A phrase is a group of words or a singular word which functions as a grammatical unit. For example, the English expression "the very happy boy" is a noun phrase containing the adjective phrase "very happy".

It can be a single word or a complete sentence. Phrases are used to describe the people, things, or events.

There are following types of phrases. They are:

Noun phrase.Adjective phrase.Adverb phrase.Verb phrase.Prepositional phrase.Gerund phraseInfinitive phraseParticipial phrase

Thus, matching the following words with its phrases

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

Learn more about Phrases, here:

https://brainly.com/question/15806900

#SPJ2

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

5. All cells
a. Are enclosed in a membrane that maintains internal conditions different from the surroundings
b. Have DNA as genetic material
c. Require energy to function
d. All of the above are correct

Answers

I’m pretty sure it’s D

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell

Answers

Answer:

c i think

Explanation:

I don't know just trying to help hope you have a good day

The answer is c a point mutation in the first chromosome of a sperm cell

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

Describe the two signals and pathways that are activated when you touch something and experience pain

Answers

The medial thalamus projects to widespread areas of the forebrain, including the somatosensory cortex. Thus there are two major ascending pathways for pain: a direct lateral spinothalamic pathway and an indirect medial spinoreticulothalamic pathway.

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

which statement best describes the difference between the sympathetic and parasympathetic nervous systems?

Answers

Parasympathetic system calms you down lets all your organs have the same amount of oxygen delivered. The sympathetic system gets your muscles moving and makes you excited.

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Other Questions
When the stress on a rock in the mantle is greater than the rock is strong ________. the rock breaks and energy is released in the form of s-waves and p-wavesa volcano eruptsa tsunami builds under the oceansedimentary rock is formed How is social control functional for society? In a certain candy store, 3 pounds of candy and 2 pounds of mints cost $10.80, and 1 pound of candy and 3 pounds of mints cost $5.35. What is the cost per pound of the mints? unas cientifica Indic que una estrella estaba en la coordenada 6,5 otro mencionado que estaba en la coordenada 6,4 y el resto del equipo la ubic en la coordenada 5,6 cul coordenadas representa mejor la posicin de su estrella? . Body tissue that can produce force is calledcartilage.tendon.muscle.nerve. 1 pointWhich explanation best identifies the relationship between mitosis andreproduction? *Mitosis is a form of sexual reproduction because the daughter cells form from onesingle parent cell.Mitosis is a form of sexual reproduction because the daughter cells are geneticallydifferent from the parent cell.Mitosis is a form of asexual reproduction because the daughter cells form a newnuclear membrane after reproductionMitosis is a form of a sexual reproduction because the daughter cells are geneticallyidentical to the parent cell. The main idea of the text "Excerpt from Betty Gordon in the Land of Oil is that people tookrisks to achieve wealth. How does the author support this idea?In thisAby describing successful stories in paragraph 5ingwellBby explaining why most people come to Oklahoma in paragraph 8O O Oby describing how many barrels of oil they hold in paragraph 6oneoilDby giving specific statistics in paragraph 3"ely.e had ashownedrive atheehive ofhave How do adult drones differ from adult worker ants?a. Drones have wings; workers don'tb. Drones have eight legs; workers have sixc. Drones lack exoskeletons; workers have themd. Drones have simple eyes; workers have compoundeyes The ratio of the length to the width the official german flag is 5:3.Sanda is making 12 german flags for a cuiture show.Each flag she makes has a length of 20 centimeters . It takes her 4 hours to make all the flag. What is the width of each flag and the average amount of time it takes sandra to make each flag? think back to a birthday party or a family event that was special to you.Explain why this event was so important. Be sure to support your answer with exaples,reasons and explanations. help me please!!!!!!!!!!!!!!! PLZZ HELP! In what organelle is the genetic material found inside?Question 3 options:Golgi ApparatusNucleusRibosomeMitochondria Select the sentence that does NOT contain an error.After the wreck, Ralph was able to climb out the drivers window.BCarters' daughter is going to attend the University of Florida in the fall.C The boss's wife is providing a catered lunch for the entire advertising division of Johnson Consulting Firm.DThomas cabin in the mountain is his favorite place to go when he needs to relax. what is the flvs spanish 1 module 5 dba questions? Food, that is not stored properly, will spoil. What is another animal that might have a larger than natural population because of human impact? Explain your reasoning. At a restaurant, the cost for one breakfast taco and one glass of milk is $2.10. The cost for two tacos and three glasses of milk is $5.15.Write a system of equations to represent this situation. DO NOT SOLVE.Let x = # of tacos and y = # of glasses of milk. I know this is easy but I got a diff answer so pls help. Worth 5 points How do teens react or deal with Gangs issues in todays society?pls help you can have 15 points but don't cheat to get the points could u define ur style and how it matches w ur personality