How Biochemistry and Biometry are interrelated to each other?

Answers

Answer 1

Answer: The biochemistry is the scientific study of the chemical substances.

Explanation:

In biochemistry the chemical composition of the chemical substances and their involvement in the vital body processes in living organisms is studied. The function and structure of the chemical compounds and their associated biomolecules is studied thoroughly. The biochemistry is studied at the molecular and the atomic level. In biometry the structural dimensions of the biomolecules is studied. This way the biochemistry is linked with biometry.


Related Questions

What do you call protozoa that you can see with the naked eye?

Answers

Answer:

Paramecium protozoa

Explanation:

because of their size (50-300 μ long) and the human eye can see things as small as about 100 µm and P.

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

7.) DURING THE FIRST ERA, THE __________ ORGANISMS EVER ON EARTH WERE
ERA, THE FIRST LIVING

Answers

Answer:

The first living organism on Earth are Bacteria in the first era.

Explanation:

Bacteria are the first organism to leave be on Earth. They came into existence about 3.5 billion years in the first era in the waters of small oceans. Then there were anaerobic hetetrophic bacteria because the atmosphere was free of oxygen before. Cyanobacteria then became the first autotrophic organisms and first photosynthesizer that release oxygen to the atmosphere after photosynthesis.

True of False: Marsh was able to prove that animals changed over time.

Answers

Answer:

True

Explanation:

Hope this helps :D Have a great day..can i hav brainliest?

I think the answer is true


:):):):):):):):)

Which type of growth occurs when population growth slows or stops after a period of exponential growth?
decreasing
exponential
linear
logistic

Answers

Answer:

B

Explanation:

Answer:

B

Explanation:

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

Which human activity negatively affects the stability of the environment?

Answers

Answer:

Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.

Explanation:

Brainliest?

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Which plant cell structures capture sunlight to produce sugars? a. vacuoles b. ribosomes c. mitochondria d. chloroplasts​

Answers

Your answer is D. It uses light energy of the sun into sugars that can be used by cells. It is like a solar panel that changes sunlight energy into electrical energy.

In the light independent reaction _____, ______, and ______ combine to make ______ and ______

Answers

Answer/Explanation:

In the light independent reaction carbon dioxide, ATP, and NADPH combine to make glucose and oxygen.

What are three differences between rocks and soil

Answers

Answer:

Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

Which of these are an important part of a scientific process? ​

Answers

Answer:

Is it multiple choice?? If it is, then show us the options

Explanation:

I have a question.... my teacher today in biology said " you think you are moving your hand by yourself, but it's actually your brain sending commands to your muscles so they can move." So I wondered.. is my brain sending commands so I can think, or am I thinking whenever I have a desire to? (Not a trick question; My friend thinks this is a trick question lol).

Answers

Answer:

you are think of a command and your brain respond to you desire

Explanation:

The image below shows how wolves and dogs compare to some other animals in the levels of classification.



Based on this chart, which pair of organisms are most closely related?

Insect and rabbit
Cat and rabbit
Insect and fish
Cat and wolf

Answers

I think the answer is cat and rabbit

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

What causes antibiotic resistance?
- Only using antibiotics when you are also doing radiation therapy
- Only using antibiotics when you are also doing chemotherapy
- Any use of antibiotics causes resistance
- We do not know

Answers

Answer:

Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria.

your welcome ;)

Explanation:

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
Not a long life story but a simple two reasons.

Answers

Answer:

1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.

2-They also don't reproduce independently but must replicate by invading living cells.

Viruses are considered non living since they are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy.

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

When does Algal Bloom occur?

Answers

Answer:

Explanation:

Algal bloom occur when there is too much of nutrients especially nitrogen and phosphorus which enhance more growth of algae and green plants in the water either fresh water or Marine water. When there is increase in algae growth, some die and cause discoloration of the water and pollution in the water.

Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?

A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?

Answers

Answer: D. Can selection in nature also lead to a new species over time?

Explanation:

Answer:

Can selection in nature also lead to a new species over time?

Explanation:

Correct on edge 2021 hope this helps :)

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells

What larger part of the body do cells make up?​

Answers

Each cell has a size and shape that is suited to its job. Cells that do the same job combine together to form body tissue, such as muscle, skin, or bone tissue.

Answer:

i pretty sure it ovum :)

Explanation:

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Practice 5: Match the statement ends to the beginnings
A Shell
D. Cell wall
B. Provides protection and support for the cell
E. Controls what goes into and out of the cell
C. Cell membrane
1. All cells have a
2. Plant cells have a
3. The cell membrane
4. The cell wall
5. The cell wall's function is similar to, or like a

Answers

Answer:

A-4. the cell wall

D-5. the cell walls function is similar to, or like a

B-2. plant cell have a

E-3. the cell membrane

C-1. all cell have a

Other Questions
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA what is 0.41891891891892 to two significant figures? Courtney got 64 out of 75 correct on a test. What is the best estimate of the percent Courtney got correct?85%75%117%64% I. Fill in the blanks below with the appropriate vocabulary in Spanish. Think about what you have learned so far.1. Es necesario estudiar mucho. = que estudiar mucho.2. Lo . No puedo ir al cine contigo.3. No voy a tomar un taxi. Voy a tomar (the bus).4. Voy a tomar el en la playa.5. Los domingos, mi familia y yo vamos a la .6. Necesito dinero. Voy al .7. Me encanta la msica! Me ir al concierto contigo.8. El metro = 9. Me gusta novelas.10. A mi hermano le gusta cartas.II. Answer the following questions with complete sentences in Spanish. When there are clues provided, use them in your answer.1. Adnde vas para comprar libros?2. Adnde van Uds. para ver una pelcula?3. Qu tienes que hacer hoy? (read a novel)4. Qu vas a hacer esta noche? (go to the museum)5. Tell someone who invites you somewhere that you are sorry but you have another engagement.6. Tienes que estudiar mucho?7. Van Uds. al correo para mandar una carta?8. Tell a friend that you would love to go to a club to dance.9. A qu hora vas a ir a la biblioteca para estudiar? (6:30)10. Por qu vas a la panadera? (I have to buy bread.)thank you! solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish Andre drew a scale drawing of his garden. Each inch represents 5 feet. What is the actual perimeter of his garden? A history question ????help Which graph represents all of the solutions of A delivery truck drove 52 miles per hour. It took 4 hours to travel between two towns. What is the distance between the two towns? Use the equation dert, where d is distance, r is rate, and t is time. The distance between the two towns is miles. Which scales are equivalent to 1 inch to 1 foot? Select all that apply. Group of answer choices 1 to 12 (1/12) to 1 100 to 0.12 5 to 60 36 to 3 9 to 108 PLEASE HURRY IM ON THE FINAL BEING TIMEDThe group of Muslims that believed in electing a new leader that would strictly follow Muhammads example were called __________.A.ShiitesB.SunnisC.AlisD.CaliphsPlease select the best answer from the choices providedABCD Energy that depends upon object mass and object height. How did African Americans take advantage of their new political rights, and what affect did this have on American politics Which of the following is not a function?a. (1,1),(2,2), (3,3), (4,4)b. (2,3), (2,4), (3,3), (3,4)c (2,4),(4,8).(10,12). (4,10)d. (2,4), (3,4), (5,4), (6,4) R IN Complete the following statement. The quotient of 5 = A is equal to the quotient of A +5. . B C D E O== 0 1 NEXT QUESTION O ASK FOR HELP A boy rubs two balloons against his sweater. One balloon acquires a charge of 3.0 E -6 C. The other balloon acquires a charge of 2.5 E -7 C. If the balloons are positioned 1 cm apart, what is the electrical force between them? Can anyone help me with these? It's a yes or no question... __________ powers are powers in which authority is shared by both the federal and state governments.A.ReservedB.FederalistC.DelegatedD.Concurrent Look at the following expression. Which operation should be done first?23 5 4 + 32 (a small 2 next to the 3)1.) 5 42.) 32 (small 2)3.) 4 + 34.) 23 5