Hii can someone help me this is science I didn’t mean to put math and this is 6th grade work btw I’ll give you BRAINLIST if you want one no joke ! Please answer does 2 questions

Hii Can Someone Help Me This Is Science I Didnt Mean To Put Math And This Is 6th Grade Work Btw Ill Give

Answers

Answer 1

Answer:

Lunar, and solar eclipse!

Step-by-step explanation:

This first one, is pretty easy! An easy way to remember it is solar is sun (both start with s), so lunar is moon!

The second one is solar eclipse, since the moon passes between the sun and earth, which causes the moon's shadow to fall on earth!

I hope this helps, and I'm here if you need anything else! <3


Related Questions

Help plsssssssssssss???

Answers

Answer:

Go 6 units to the right and then 8 units up.

Answer:

so Go 6 units to the right and then 8 units up. and then you should get your point on the graph id apreciate brainliest

Step-by-step explanation:

5d-3+2d=4d+9. I need help can you help me solve this problem

Answers

Answer:

D=4

Step-by-step explanation:

Answer:

d=4

Step-by-step explanation:

5d - 3 +2d = 4d +9

7d-3=4d+9

-4d    -4d

3d-3=9

     +3   +3

3d=12

divide both sides by 3

d=4


You make $443 per week, and have claimed five exemptions. How much money will be withheld from you in a year?

Answers

Answer:

Choice A. $2,392 is the correct answer

Choice A is the correct one

Help will give brainlist!
If correct. Thanks!

Answers

Answer:

B y=0.5x-1

Step-by-step explanation:

Answer:

Y=-1/2x-1

Step-by-step explanation:

The slope is found using rise/run

Y-int can be found on the graph


Are the two triangles similar?

Answers

Answer:

No, they are not.

Step-by-step explanation:

HELPP! I need an explanation an answer quicck

Answers

Answer:

C. -1,-2

Step-by-step explanation:

the answer is -1 , -2

The complex numbers z1 and z2 are graphed. Which point represents z1 – z2?

Answers

Answer:

A EDGE 2020

Step-by-step explanation:

I got it wrong twice and it gave me the answer :)

The point represents z₁ - z₂ will be A. Then the correct option is A.

What is a complex number?

The complex number is the combination of the real part and the imaginary part. Then the complex number is given as

⇒ a+bi

The complex numbers z₁ and z₂ are graphed.

The expression of z₁ and z₂ are given below.

z₁ = 4 – i

z₂ = –3 – 2i

Then the difference between z₁ and z₂ will be

z₁ - z₂ = (4 – i) – (–3 – 2i)

z₁ - z₂ = 4 – i + 3 + 2i)

z₁ - z₂ = 7 + i

Then the correct option is A.

More about the complex number link is given below.

https://brainly.com/question/10251853

#SPJ2

Kevin spends $11.25 on lunch every week during the school year. If there are 35.5 weeks during the school year, how much does Kevin spend on lunch over the entire school year?

Answers

Answer:

399.37

Step-by-step explanation:

multiply the amount each week by the amount of weeks to get the answer :)

Can Any One Help
WILL GIVE BRAINLIEST

Answers

1) A

Equations simplified:

A: y = 2x + 3

B: y = -3x + 3

2) Red is A, Blue is B

(THIS IS A TEST I NEED HELP)
In the rectangular prism, PQ is the diagonal. Find the length of
PQ given PR = 7, RS = 4, and QS = 4.
A 4
B 9
C 12
D 15

Answers

Answer:

Option (B)

Step-by-step explanation:

Length of PR = 4

RS = 4

QS = 4

For the length of PT,

PT² = RT² + PR² [Since, PT is the diagonal of rectangle PRT]

PT² = QS² + PR² [Since, RT ≅ QS]

PT² = 4² + 7²

PT² = 16 + 49

PT² = 65

Now for the length of PQ,

PQ² = QT² + PT²

PQ² = RS² + PT² [Since, QT ≅ RS]

PQ² = 4² + 65

PQ² = 16 + 65

PQ = √81

PQ = 9

Therefore, length of diagonal PQ is 9 units.

Option (B) will be the answer.

Leo gathered data about the weight, in pounds of his suitcase when it was packed for trips lasting different numbers of nights. the data he gathered is organized in the table. (PLEASE ANSWER FOR REAL!!! NO BS LIKE RANDOM LETTERS OR IDK!)

Nights (x) 2, 3, 4, 5, 6
Weight (y) 17, 22, 26, 30, 35​

Answers

Answer:

y=4.4x+8.4

Step-by-step explanation:

Given the coordinates of a rectangle A(2,5) B(6,5) C(6,-5) and D(2,-5), write the equations of the lines of reflection

Answers

Answer: D

Step-by-step explanation: because I got the same question and got it right

diagram of ABCD to find m

Answers

Answer:

since the pairs of opposite lines in the diagram are parallel the measurement of B is also 63

to fine A and C simply subtract 180 - 63 which gives us 117 so

A = 117

B = 63

C = 117

D = 63

Kaylee put $240.00 in a bank account that gains 25%
interest annually.
How much interest will be accumulated in a year?
S???
If Kaylee makes no withdrawals, how much money will be
in the account after a year?
$???

Answers

Answer:

S=720

Step-by-step explanation:

25$ of 240 =60

60×12months=720

Jonathan is driving to his grandma’s house. Jonathan’s car is going 75 mph and he has to go 340 miles still. Brighton, Jonathan’s cousin, is leaving his house and is traveling 70 mph and has to 320 miles. Who gets to grandma’ house first? How much faster do they get there?

Answers

Answer:

Johanatho will get in 4.53 hours. joahnathons cousin will take 4.57 hours.

Step-by-step explanation:

340/75=4.53

320/70=4.57

PLEASE HELP!!
What is the slope for runner 1 and runner 2 ?

Answers

I don’t about 2 but the slope for 1 is 2

these are two different questions

Answers

Hi sorry I don’t know how to do that but can u tell me how do add 2 picks in a question

Do anybody know how to do this ? This typa work is unnecessary bruh I hate school !

Answers

Man, I have to be honest with you, I have no clue. But here is something else though. I had to take Geometry last year, and you are right. It does suck. But, you will get through it! There is a light at the end of the tunnel and you will get it! Keep up the good work!

Answer:

m<1 = 87

Step-by-step explanation:

Bro I got you! You ain't gotta hate school no more!

Right the equation like this

m<1 + m<2 = <TSV (plug in)

m<1 + 65 = 152 (subtract 65 from 152 to get m<1)

m<1 = 87

There you go!

Hope this helps ya!

The first equation in the system of equations that models this situation is x+y=70, where x represents the number of 2-point questions the number of 4-point questions. What is the other equation in the system? Enter the correct answer in the box. Substitute numerical values in the expression for A, B, and C.

Answers

Answer:

2x+4y=150

Step-by-step explanation:

Top answer is right as it is shown in the picture below!

Analyze the diagram below and complete the instructions that follow.
7
y
450
X
Find the value of x and the value of y.
A. x = 16, y = 9V2
B. x = 7, y = 16 V2
C. x= 16V/, y = 7.12
D. x= 7/3, y = 16

Answers

Answer:

[tex]A.\ ~~x=16,~ y=9\sqrt{2}[/tex]

Step-by-step explanation:

We have completed the diagram with some lengths that come directly from the figure's symmetry.

Note the triangle formed at the left side of the trapezium is isosceles because it has an angle of 90° and another angle of 45°.

This means the base of the triangle has the same length as the height of 9.

This means the total base of the trapezium is x = 9 + 7 = 16

The right triangle must satisfy Pythagora's Theorem:

[tex]y^2=9^2+9^2[/tex]

[tex]y^2=2*9^2[/tex]

[tex]y=\sqrt{2*9^2}[/tex]

Simplifying the radical:

[tex]y=9\sqrt{2}[/tex]

The correct answer is: [tex]\mathbf{A.\ ~~x=16,~ y=9\sqrt{2}}[/tex]

A fundraiser is being held to support a local nonprofit organization. Admission costs $10, and each raffle ticket costs $3. There are no other possible costs. If an event-goer pays the admission fee and buys x number of tickets, what type of function should be used to model the total amount spent by the event-goer at the event?

Answers

Answer:

y= 10+ 3x

10 is the admission fee

3x is the cost for each ticket

y is the total

The function for the total cost (y) spent by the event-goer at the event is

y = 3x+10

What is a function?

A function is defined as a relation between a set of inputs having one output each. In simple words, a function is a relationship between inputs where each input is related to exactly one output.

Given that, Admission costs $10, and each raffle ticket costs $3. There are no other possible costs.

Let the total cost be y,

Therefore, establishing the function, for x number of tickets.

y = 3x+10

Hence, the required function is y = 3x+10

For more references on function, click;

https://brainly.com/question/21145944

#SPJ6

Please help me on this

Answers

Answer:

a: -1,-1

b: 2,3

c:6,7

d: 5, 7

Step-by-step explanation:

Answer:

A -1,-1

B 2,3

C 6,7

D 5,-3

Step-by-step explanation:

You have to plug in each plotted point into the formula that was given to you.

Ex - A is plotted point is (-4,-3) so you plug in (-4+3,-3+2) which will give you (-1,-1)

Miguel places his 13-foot ladder 5 feet from the edge of his house. How high does the ladder reach? A. 8 feet B. 12 feet C. 13.9 feet D. 144 feet E. 194 feet

Answers

Answer:

A - eight feet

Step-by-step explanation:

20 character rule can be dumb sometimes

The Pythagoras is the sum of the square of two sides is equal to the square of the longest side. The height of the house is 12 feet, then the correct option is B.

What is a right-angle triangle?

It is a type of triangle in which one angle is 90 degrees and it follows the Pythagoras theorem and we can use the trigonometry function.

Miguel places his 13-foot ladder 5 feet from the edge of his house.

Then the height of the house is given by the Pythagoras theorem.

P² = H² - B²

P² = 13² - 5²

P² = 169 - 25

P² = 144

P = 12

Then the height of the house is 12 feet.

More about the right-angle triangle link is given below.

https://brainly.com/question/3770177

Identify the constant of proportionality.

Answers

Answer:

14

Step-by-step explanation:

If you divide -28 and -2, you get 14 which is the constant of proportionality. You can try to multiply -4 and 14 to check which you get -56. The graph shows that and it's the correct answer!

Can someone help me please

Answers

Answer:

A

Step-by-step explanation:

When 5 goldfish were added, the cost increased by $1.50, so we can divide 150/5 to find the increase of cost from one goldfish which is 30 cents.

(4x + 2y + 6) + (7x + 3y - 4) + (x - 2y + 1)
Can someone break this down step by step so i know how to do it please
thankyou .

Answers

Answer:

12x+3y+3

Step-by-step explanation:

Let's simplify step-by-step.

4x+2y+6+7x+3y−4+x−2y+1

=4x+2y+6+7x+3y+−4+x+−2y+1

Combine Like Terms:

=4x+2y+6+7x+3y+−4+x+−2y+1

=(4x+7x+x)+(2y+3y+−2y)+(6+−4+1)

=12x+3y+3

 

 

Answer:

12x + 3y + 3

General Formulas and Concepts:

Algebra I

Combining Like Terms

Step-by-step explanation:

Step 1: Define

(4x + 2y + 6) + (7x + 3y - 4) + (x - 2y + 1)

Step 2: Simplify

Combine like terms (x):                    12x + 2y + 6 + 3y - 4 - 2y + 1Combine like terms (y):                    12x + 3y + 6 - 4 + 1Combine like terms (Z):                    12x + 3y + 3

Help Plz 10pts will be given

Answers

Answer:

Is the first one 3 over 7

Step-by-step explanation:

Arnold has $24 to spend at the movies. His ticket is $12. He bought popcorn, candy bar, and soda. Popcorn is double the prize of the soda. The soda and candy bar are same prize. How much did he pay for the soda?

Answers

Given:

Arnold has $24 to spend at the movies.

Ticket = $12

Popcorn is double the price of the soda.

The soda and candy bar are same price.

To find:

The price for the soda.

Solution:

Let x be the price of soda.

According to the question,

Price of candy = Price of soda = x

Price of popcorn = 2(price of soda) = 2x

Total amount = Ticket + Popcorn + Soda + Candy

[tex]24=12+2x+x+x[/tex]

[tex]24=12+4x[/tex]

[tex]24-12=4x[/tex]

[tex]12=4x[/tex]

Divide both sides by 4.

[tex]\dfrac{12}{4}=x[/tex]

[tex]3=x[/tex]

Therefore, the price of soda is $3.

One degree of longitude at the equator is approximately 111 km. As we move north or south the size of a degree changes. How many kilometers would 1° of longitude measure in kilometers at 45° latitude north? A. 55.5 kilometers B.222 kilometers C. 444 kilometers D. 0 kilometers

Answers

Answer:

B.

Step-by-step explanation:

55.5 kilometers would be 1° of the longitude measure in kilometers at 45° latitude north.

What are longitude and latitude?

Latitudes are horizontal lines that indicate how far away from the equator a location is. Longitudes are vertical lines that represent the east and west directions relative to Greenwich, England's meridian. Cartographers, geographers, and others can pinpoint points or locations on the globe by combining latitude and longitude.

Given, At the equator, one degree of longitude is around 111 kilometers. The size of a degree fluctuates as we go north or south. since the equator is perpendicular to the pole. which is 90 degrees hence it's asking distance of 45 therefore from the proportionality concept in a right angle triangle. the distance at 1 is at 45 latitudes is 111/2 or 55.5.

Therefore, At 45° latitude north, 55.5 kilometers would represent 1° of the longitude measurement in kilometers.

Learn more about longitude and latitude here:

https://brainly.com/question/13492273

#SPJ2

the ratio of boys to girls is in a class 4:3. There are 35 students in the class. How many students are boys ?
What is the formula?​

Answers

Answer:

ratio 4x:3x

total= 7x parts = 35(given)

x= 35/7 =5

boys = 4x = 20

girls = 3x = 15

The number of boys are more by 20-15 = 5.

Step-by-step explanation:

Answer:

20 boys 20:15

Step-by-step explanation:

helpful??

Other Questions
which energy resource is renewable A. oil B. natural gas C. moving water D. Fossil fuel A 0.25-kilogram ball is observed to accelerate at 4,000 m/sec2 as it is hit with a bat.How much force is exerted on the bat by the ball? The circumference of a circular piece of plot is 440m. find the areapie is 22/7 What is a similarity and a difference in European exploration of the East and of the West? One thing all the delegates had in common WILL MARK BRAINLIEST IF CORRECT PLEASE HELP!!Which graph represents this system?y = one-half x + 3. y = three-halves x minus 1A. On a coordinate plane, a line goes through (0, 3) and (4, 5) and another goes through (0, negative 1) and (2, 2).B. On a coordinate plane, a line goes through (0, 3) and (1, negative 3) and another goes through (0, negative 1) and (3, 1).C. On a coordinate plane, a line goes through (negative 1, negative 2) and (1, 4) and another goes through (0, 1.5) and (1.5, 0).D. On a coordinate plane, a line goes through (negative 3, negative 3) and (0, 3) and another goes through (0, negative 1) and (3, 1). I neeed help pleaseeee GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182