Hi everyone this is the last question can you please help me for brainliest

Hi Everyone This Is The Last Question Can You Please Help Me For Brainliest

Answers

Answer 1
I think that the answer is 8

Related Questions

A toy store’s percent of markup is 30%. A model train costs the store $50. Find the markup.


$65

$35

$166.67

$15

Answers

Answer:  $15

Step-by-step explanation:

To find the markup price just multiply 30% by the amount.

30% * 50  

0.3 * 50 = 15

Answer:

Markup = $15

Step-by-step explanation:

30% of $50 = $15

30 POINTS!
Select all that apply.

Two numbers where the y-coordinate is 10 less than the x-coordinate.

o Point C

o Point B

o Point A

o Point E

o Point D

Two numbers with a sum of two.

o Point C

o Point B

o Point A

o Point E

o Point D

Two numbers where the y-coordinate is 10 less than the x-coordinate.

o Point C

o Point B

o Point A

o Point E

o Point D

Two numbers with a sum of two and where the y-coordinate is 10 less than the x-coordinate.

o Point C

o Point B

o Point A

o Point E

o Point D

Answers

Answer:

cb, ba

Step-by-step explanation:

Find the arc length of the partial circle.
Either enter an exact answer in terms of \piπpi or use 3.143.143, point, 14 for \piπpi and enter your answer as a decimal.

please help!!

Answers

Answer:

1/2pi

Step-by-step explanation:

Since the formula for circumference is 2*pi*r and we know the R=1 so the of the whole circle is 2pi. This is a quarter of a circle so the answer is 1/2pi  

Answer:

1/2pi

Step-by-step explanation:

Cheerios $3.89 for 17 oz. $ [ Select ] per ounce VS. Option 2: Apple Jacks $2.89 for 13 oz. $ [ Select ] per ounce Which is the better deal?

Answers

I think your best bet is to go with Apple Jacks.
The better deal is Cheerios because
If you take the ounces for each (17 & 13)
And divide them by the price ($3.89 & 2.89)
It would give you the amount 1 ounce would be (aka the constant) and the constant for Cheerios is 4.3701 where as the constant for Apple Jacks is 4.4981. Therefore, Cheerios is the better deal cause you get more.

Need help please 15 points

Answers

Answer:

Paula's tub filled much more faster becasue it has less water to fill up

Step-by-step explanation:

Can someone please explain the Slope formula? Don't quite get it. I'm working on edge Physical science grade 8

Answers

Answer:

ok is that a question or not but if it is i may be help u

Answer:What About y = mx + b ? You may already be familiar with the "y=mx+b" form (called the slope-intercept form of the equation of a line). It is the same equation, in a different form! The "b" value (called the y-intercept) is where the line crosses the y-axis.

Step-by-step explanation:

URGENT BRAINLEIST CHANCEWhich of the following expressions cannot be written as an integer?

-3 0
18/3
1.2 × 10 -2
√49

Answers

Answer:

1.2*10^-2

Step-by-step explanation:

-3^0 is 1, because anything to the power of 0 (except for 0) is always equal to 1. 1 is an integer, so this is not the answer.

18/3=6, and 6 is an integer, so this is not the answer either.

1.2*10^-2 = 1.2*0.01 = 0.012, which is not an integer, so this is the answer.

49 is an integer, so this is not the answer:

Therefore, the answer to this problem is 1.2*10^-2

Hope this helped!

Answer:

[tex]1.2*(10-2)[/tex] cannot be written as an integer.

Explanation:

Fractions and decimals are not integers. All whole numbers and natural numbers are integers.

You can immediately identify that [tex]1.2*(10-2)[/tex]  cannot be written as an integer because the decimal is 1.2 and the only way it could become an integer is if it was multiplied by a number ending in 5 or with 5 as a factor (5,1 0, 15, 20, and so on). Also, it has a decimal point that isn't being multiplied by another decimal/fraction. In some cases, decimals or fractions multiplied by each other can equal an integer, but it's that's not the case in this instance.

However, if you couldn't identify this or you needed to check you answer, you could solve the expressions:

[tex]1.2*(10-2)\\1.2*(8)\\9.6[/tex]

9.6 is a decimal, therefore it is not an integer.

[tex]-3 + 0 = -3\\-3*0= 0[/tex]

I don't know if you were attempting to add or multiply, but in both cases, the sum and product equal an integer.

[tex]\frac{18}{3} = 6[/tex]

18 is divisible by 3, so you can assume that the quotient will be an integer. (3*6 = 18, to check your answer)

(To know if something is divisible by three, add the numbers of the dividend. If they equal a number that can be divided by three, you can assume that you'll get an integer and whole number.

For example: 1 + 8 = 9, 3*3 = 9)

[tex]\sqrt{49} =7[/tex]

The square root of 49 is 7. If you've memorized your square roots, you could identify quickly that the square root would be an integer. If you haven't it's okay, keep working on it!

I hope this helps!

The Suarez family paid $15.75 for 3 movie tickets. How much would they have paid for 12 tickets?

Answers

Answer:

$63

Step-by-step explanation:

15.75 / 3 = 5.25

5.25 is what each ticket was worth

5.25 * 12 = 63

Answer:

$63

Step-by-step explanation:

15.75 divided by 3 = 5.25 then 12 * $5.25 = $63

Hope this helps! :>

HELP PLLZZZZZZZZZZZZZZ MARKING BRAINLIEST IF YOU DONT KNOW DONT ANSWER


Using complete sentences post a detailed response to the following.

Although technology was not specifically mentioned in the unit, there is no denying it has become such a huge part of our lives – including our fitness. What are some ways that increased technology use has negatively impacted personal fitness? What are some ways that it has helped personal fitness? Explain.

Explain your answer


- 2-4 sentences
- include a negative example and explain
- include a positive example and explain
- answer using complete sentences

Answers

Answer:

why technolgy is having a negitive impact on us:

1. affect our sleeping habbit.I say this because we get so addicted to them that when we need to sleep for our mental and physical health. we don't want to go to because there is so much stuff on the internet that we want to see and that causes us to mess up our sleeping habbits!  

2. pain: when we our on our lectronics we don't realize how we are sitting and so that causes neck pain and back pain and including bad posture!

positive impact:

1. a positive impact is that you can learn alot from the internet but not my point. My point is that there is alot  of learning opportunities ou there and that you don't have to stay in one spot to do something online you can travel while still doing what you have to!

i am so sorry if this is wrong and am so sorry this took a long time

Solve for g. Show your work!
g+7 4=15

Answers

Answer:

g = 12

Step-by-step explanation:

g + 7 - 4 = 15

Combine like terms

g +3 = 15

Subtract 3 from each side to isolate g

g+3-3 = 15-3

g = 12

Answer:

g = -59

Step-by-step explanation:

g + 74 = 15

subtract 74 from both sides

g = -59

A farmer had 22.75 bushels of corn. He sold 12 2/5 bushels at the market. His three friends bought the remaining bushels of corn. If each person bought the same amount, how many bushels did each friend purchase?

Answers

Answer:

Each friend bought 3.45 bushels of corn.

Step-by-step explanation:

12 2/5 as a decimal is 12.40. You do 22.75 minus 12.40, which gives you 10.35. Next you do 10.35 divided by 3, which gives you your final answer of 3.45.

Plz help me with these, I don't understand this subject.

Answers

Answer:

A

Step-by-step explanation:

I might be wrong but it seems right.

Answer:

A

Step-by-step explanation:

That's just how you set up these equations don't know how to explain more

I NEED HELP ON THIS MATH PROBLEM


What is the output of y=6x−11 when the input is 5?
Enter your answer as a number, like this: 42

Answers

X=2 because if you substitute y for 5 and solve you get this answe

Answer:

19

Step-by-step explanation:

y=6x-11

y=6*5-11

y=30-11

y=19

CHECK:

19=6*5-11

19=30-11

19=19

PLEASE HELP A GIRL OUT!!

Answers

Answer:

C

Step-by-step explanation:

It is C because the question asks for 1/4th of the wholw angle =45 degrees

hope this helps

Answer:

I think its c

Step-by-step explanation:

Please Help Me i will Give Brainliest

Answers

Answer:

C 2/3

Step-by-step explanation:

b/5 = 8/16

(character limit)

Answers

b is 2.5 because b/5 should be 1/2, 2b is 5, 5/2 is 2.5
2.5 i believe
16/8=2 so then 5/2=2.5

HELP I WILL MARK BRAINILEST

Answers

A) yes

B) No

C) Yes

D) No

Hope this helps!

Answer:

A) yes

B) No

C) Yes

D) No

Step-by-step explanation:

WILL GIVE BRAINLIEST!!!!!

Which would be used to solve this equation? Check all that apply.

subtracting 3 from both sides of the equation
multiplying both sides of the equation by 3
dividing both sides of the equation by 3
substituting 4 for p to check the solution
substituting 36 for p to check the solution

Answers

Answer:

1 3 4

Step-by-step explanation:

umm i suck at explaining sorry

Answer: Multiplying both sides of the equation by 3

substituting 36 for p to check the solution

Step-by-step explanation: To undo the division of p by 3, one multiplies by the inverse of 1/3. That is, one multiplies by 3.

Then you have 3(p/3) = 3(12)

p = 36 simplify

To check this work, you can substitute 36 for p:

36/3 = 12 true statement So, the solution process is multiply both sides of the equation by 3 substitute 36 for p to check the work

simplify 4 to the square root of 3 ÷ 5 to the square root of 3

Answers

Answer:

(4)/(\sqrt(3))

Step-by-step explanation:

heyy press this question! i need help, this not the last question, i have like 4 mores sooo...

Answers

Answer:

54619.875 or 55,000

Step-by-step explanation:

5020 times 9.9 is 49698

1575 times 3.125 is 4921.875

49698 plus 4921.875 is 54619.875

Answer:

A. 50,00 pounds

Step-by-step explanation:

4,921.875+49,698=54,619.875 Round down to 50,000.00

Will mark Brainlist!

Answers

Answer:

4,880

Step-by-step explanation:

33.2% x 14,700 = 4880 employes

Answer:

4,880

Step-by-step explanation:

33.2% x 14,700 = 4880 employees

what is 43,6480 x 34,4608 =

Answers

Answer:

The answer is 1504.1449984 , hope this helps :)

Answer:

436,480 multiplied by 344,608 is 150,414,499,840.

Step-by-step explanation:

hope this helped (:

if you reflect any shape across the x-axis and then rotate it 90 degrees clockwise about the origin, do you get the same results as if you reflect it across the y-axis and then rotate it 90 degress counterclockwise about the origin? what does this mean?

Answers

Yes, a shape can be reflected across the x-axis and then rotated 90 degrees in a clockwise direction around the origin to achieve the same results as a shape reflected across the y-axis and rotated in a counterclockwise direction. This implies that these two transformational sequences are similar.

What is reflection in Mathematics?

A reflection is referred to as a flip in geometry. A reflection is the shape's mirror image. A line, called the line of reflection, will allow an image to reflect through it. Every point in a figure is said to reflect the other figure when they are all equally spaced apart from one another.

To know more about reflection refer to :

https://brainly.com/question/26494295

#SPJ2

What is the slope of the line?

Answers

Answer:

The slope is 2/1

Step-by-step explanation:

Answer:

-2

Step-by-step explanation:

First thing you should notice first is that the line is going up to the left, that means that the slope will be negetave. Then, follow the rise over run method. Start at any point on the line, im going to use (0,1). go up 2 and over 1. You get -2/1 aka -2. I hope this helps!

Estimate how many times larger 6.1×10^7 is than 2.1×10^−4. PLEASE WILL GIVE BRAINLIEST!!!!!! cmon plsssss

Answers

The answer is 2904. Enjoy

x = y - 3
2x + y = 12

Answers

X = -1/2 y = 6 I’m pretty sure
the answer is 6 :) just did it

Luke is on a diving board 8 feet above the water. His dive takes him down 10 feet. Where is Luke at the end of his dive before he comes back to the surface of the water?

Answers

Answer:

2 feet lower than the surface of the water

Step-by-step explanation:

8-10=-2

Answer:

Step-by-step explanation:

8 feet below water

a number x divided by 8 is less than -2

Answers

Answer:  x/ 8 < -2           and x< -16

Step-by-step explanation:

A numer x is divided by 8  is the same as   x/ 8   and x/8 has to be the less than  -2  so it will be    x/8 < -2  

x/8 < -2   TO solve the inequality, multiply 8 on both sides  to get

x < -16

The solution of expression is,

⇒ x < - 16

We have to given that,

An algebraic expression is,

''a number x divided by 8 is less than -2''

We can write as,

⇒ x / 8 < - 2

Solve for x,

⇒ x/8 < - 2

Multiply by 8;

⇒ x < - 2×8

⇒ x < - 16

Therefore, The solution of expression is,

⇒ x < - 16

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ6

Which statement is true about the value of the expression below?
(-2^3)^-2
Answer Options:
It is less than -1.
It is between -1 and 0.
It is greater than 1.
It is between 0 and 1.

Answers

Answer:It is between one and zero

Step-by-step explanation:

Answer:

0.015625 so this is between zero and 1

Step-by-step explanation:

An electrician needs 1/3 of a roll of electrical wire to wire each room in a house. How many rooms can he wire with 1 2/3 rolls of wire?

Answers

Answer:

5 rooms

Step-by-step explanation:

1/3

1/3

1/3

1/3

1/3

Yeah it is 5. 1/3 + 1/3 + 1/3 + 1/3 + 1/3 is 1 and 2/3. So the electrician can only wire 5 rooms.
Other Questions
Joe would have earned $504 for working a 42 hour week but he was sick and missed 4 hours. How much did he earn? Help asap please!! I will mark you as brainliest :) help meWhat are the best exercises that will help increase my target heart rate to at least 60% or above? As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz Connections Academy Geometry10A semester exam. Does anyone have the answers im 1% away from passing. d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A?