Hey there! please help I can't find the answer in my textbook for these notes :)
During the _________, ATP and NADPH molecules produced in the light-dependent reactions are used to produce high-energy sugars from carbon dioxide.
Thank you so much!

Answers

Answer 1

Answer: Overview of the Calvin cycle

In the Calvin cycle, carbon atoms from CO2​start text, C, O, end text, start subscript, 2, end subscript are fixed (incorporated into organic molecules) and used to build three-carbon sugars. This process is fueled by, and dependent on, ATP and NADPH from the light reactions.


Related Questions

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

What are three organelles that are involved in the production of proteins?

Answers

Answer:

golgi bodies, ribosomes and endoplasmic reticulum.

Explanation:

Hope this helps!

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

What is the difference between prokaryotic and eukaryotic cells?

Answers

The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).

The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

WILL GIVE 20 POINTS AND BRAINLIEST PLS HURRY

In order for a scientific explanation to be valid, it MUST be based on evidence from _[blank]_.
a. hypotheses of scientific experiments
b. a credible scientific journal
c. the latest scientific research
d. observations of the scientific investigation

Answers

Answer:

a. hypotheses of scientific experiments

Explanation:

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines

Answers

Answer:

c.

composting

Explanation:

Composting is not a technological way of improving air quality (Option C).

What is air quality?

Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.

Air quality is fundamental for maintaining overall health and increasing the quality of life.

Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).

In conclusion, composting is not a technological way of improving air quality (Option C).

Learn more about air quality here:

https://brainly.com/question/1211889

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Other Questions
What was the trend in immigration and birth region between 1900 and 1990? .Why is it important to be honest and straightforward with doctors?so they can bill for the visit appropriatelyso they can inform a patients parents correctlyso they will be able to discuss the case with other peopleso they know what medications are safe and unsafe to prescribe solve x 3+3(x+2)=-24 HELP!! Unscramble the word gelo est. How much water would need to be added to 1092 mL of a 54.7 M NaCl solution to make a 0.25 M solution? The cost of a magazine is $x and the cost of a newspaper is $(x -3). The total cost of 6 magazines and 9 newspapers is $51. Write down and solve an equation in x to find the cost of a magazine, Nadine saw that there was 4/5 of a pie left after their family picnic. Each slice of pie was 1/15 of the total pie. How many slices of pie are left? Please help asap- will give brainliest:See the image attached and choose ONE Rewrite the function by completing the square. g(x)= x^2-x-6g(x)- __(x+__)^2+___Thanks :) Joseph had 380 heartbeats in 4 minutes. How many did he have in 15 minutes? (Write a proportion) What was the bull moose party? whats 1.283.3 times 2.7 A museum requires a minimum number of chaperones proportional to the number of students on a field trip. The museum requires a minimum of 333 chaperones for a field trip with 242424 students. All of these affect weather except! A. Air pressure B. HumidityC. BarometerD. Wind speed PLEASE HELP ASAP! ILL GIVE BRAINLIEST!This is a graphic organizer that could be used to take notes.A graphic organizer shows 6 boxes on 3 levels of hierarchy with lines connecting boxes between the levels.How should this graphic organizer best be used?to note dates in a sequenceto show how ideas connectto record any assignmentsto identify vocabulary terms A golf ball flies through the air after being struck with a golf club. Which of the following statements describes the force on the ball as momentum is transferred between the club and ball?A. The ball does not experience any force.B. The force experienced by the ball is greater than the force experienced by the club.C. The force experienced by the ball equals the force experienced by the club.D. The force experienced by the ball is weaker than the force experienced by the club. 17 Which changes decrease the rate of reaction between magnesium and air?1.heating the magnesium to a higher temperature2.using a higher proportion of oxygen in the air3.using magnesium ribbon instead of powdered magnesiumA 1, 2 and 3B 1 onlyC 2 onlyD 3 only A while back, either James borrowed $12 from his friend Rita or she borrowed $12 from him, but he can't quite remember which. Either way, he is planning to pay her back or ask that she pay him back this afternoon. If he has $42.80 in his wallet, which equation represents the amount of money he may have after he sees Rita? |x 42.80| = 12 The driver of a car slams on the brakes when he sees a tree blocking the road. The car slows uniformly with acceleration of -5.05 m/s2 for 4.05 s, making straight skid marks 65.0 m long, all the way to the tree. With what speed does the car then strike the tree?Find the answer in m/s. Assume a file containing a series of integers is named numbers.txt and exists on the computers disk. Write a program that reads all of the numbers stored in the file, calculates their total and displays it.Very Important: The file could have any number of numbers, so you need to use a loop to process the data in the file