Help me I’ll give 50 points helppp!

Help Me Ill Give 50 Points Helppp!

Answers

Answer 1

Answer:

2 Refraction, Transition/bouncing?

7. Opaque, absorbs

Explanation:

Answer 2
StraightLustre,ShineMirrorTransparency, PropertyNot deep,less fastersee,redoblique ,blockswood,more metals,Board,pen

Related Questions

what direction was the texas annexation in?

Answers

They faced washington DC

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

what were some of the earliest life forms? and what were they like

Answers

The earliest forms of life were microorganisms. These organisms appeared about 3.77 billion years ago.

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

Not all members of a species are the same. Every species exhibits (blank)
. For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their (blank)
to their offspring.

Answers

variation and traits

Answer:

Not all members of a species are the same. Every species exhibits  

variation.

For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their traits, genes to their offspring.

Explanation:

Got it right. Hope it helps :)

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?

Answers

Answer:

are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.

Explanation:

1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone​

Answers

Answer:

1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes

Explanation:

The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

How does biology affect behavior?

Answers

Answer:

some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.

Explanation:

There you go

Biology is a normal thing it diesnt really effect us

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

Other Questions
Que pasara si llegars a tu casa y encontrars a otra familia diferente ala tuya viviendo ah? M is the midpoint if AB . If coordinates of A are (-1,5) and the coordinates of M are (3,3) , what are the coordinates of B? Write A or P for numbers 1-10 if the verb in the sentence is in the active or passive voice.(PLEASE HELP, ILL MARK BRAINLIEST) 18)The base of a triangle is 545 cm and the height is 388 cm. What is the area of the triangle? Recall: A-8y133 cm?12487 cm?45\110 cm?75y22 cm What is the gist of "Words Do Hurt Like Sticks and Stones." Solve the following compound inequality Choose the correct location and hand placement to perform abdominal thrusts on a choking child What is the energy source that allows photosynthesis to occur? What sentence has correct pronoun-antecedent agreement?Justin forgot to check in and sign their name at the front desk.Most of the art supplies were stored until it was ready to be used.Several of the volunteers brought his or her tools to the building project.Other members of your team may ask you to give them advice. Why is emotional contagion important in organizations? What effect does the increasing reliance on e-mail have on this phenomenon?hey i really need help for this please help me this is for 30points 1Select the correct text in the passage.Which sentences highlight the correct way of preparing stewed potato?Olivia chooses to prepare stewed potato during the weekend. She warms vegetable broth over medium heat. She then cuts potatoes into 1"chunks. She adds potatoes to the broth, covers the lid and cooks it at low heat until the potatoes become tender. Jessica, too, likes stewedpotato. She peels, and boils potatoes until tender. She then uses an electric mixer to mix potatoes and salt until the dish shows a smoothtextureResetNext Use the rules of significant figures to answer the following question:54.313 12.09A. 657B. 660C. 656.64D. 656.6 select the correct solution for 6x = 30(A) x = 24(B) x = 1/5(C) x = 5 (D) x = 36 Can someone please help me. Its hard and I dont understand. Based on Webster's words, many southerners would have most likely concluded thatabolitionist forces from the North were about to invade.O northerners were going to leave the Union out of anger.the possibility of compromise on the issue of slavery still existed.the North was going to stop importing cotton from the South. I need help...Please help to find ... i got the 2nd answer wrong because om someone but I can retry it :P What is the ability for a substance to flow ill give brainliest dont mind my crusty computer