[tex] \huge\boxed{ \boxed{ \underline \mathcal{Answer}}}[/tex]
The Required genotype of the Man should be BB in order to have only brown eyed offsprings.
Correct option - C. BB
_____________________________
[tex]\mathrm{ ☠ \: TeeNForeveR \: ☠}[/tex]
HELPPp!!!!!!I’ll mark u brainly
Answer:
Genotypes - Phenotypes:
TT - Thin
Tt - Thin
tt - Wide upside down
LL - Lopsided
Ll - Lopsided
ll - Parallel
VV - Vertical
Vv - Veritcal
vv - Horizontal
PP - Pink
Pp - Pink
pp - Red
What is the difference between a prokaryotic cell and a eukaryotic cell?
Answer:
Size is 0.1- 5.0 um Size is 5-100 um
Nucleus is absent Nucleus is present
Membrane-bound nucleus absent. Membrane-bound Nucleus is present.
Explanation:
here are some
Answer:
One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one
Explanation:
Glad I could help! <3
Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos
From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.
What are coral reefs?Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.
The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.
The balance in coral reefs can be disrupted by human activities such as:
Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photosHowever, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.
Learn more about coral reefs at: https://brainly.com/question/10970167
Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk
Answer:
Honey
Explanation:
Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.
pls answer pls please
Answer:
1.it's beak is pointed and slightly curved at pointed
2.it's upper part is brown and lower part is white
3.it's legs is black
Explanation:
please help me with this
Answer:
prob b
Explanation:
A person is observing the oscillations of a wave. If the wave source begins to move away from the person, what will the person notice?
A.
The wavelength will decrease.
B.
The wave appears to have a different amplitude.
C.
The wave appears to change speed.
D.
The wave appears to oscillate at a different rate.
the wave appears to oscillate at a different rate
Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *
There has a been decrease in the diversity of plants in the grasslands of the Edward's plateau. What has caused this to occur?
Which of the following are not properties of lipids?
Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.
All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.
Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.
Explanation:
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only
Answer:
C. Natural cycles of cooling and heating is the best option.
Explanation:
C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.
Please give brainliest.
The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.
Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
I need the answer no links and no putting random stuff I need the answer fast
Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
Explanion:
its already the answer
Need help ASAP! Will give brainliest;) NO links please, will report.
Which statement is part of Darwin’s theory of evolution by natural selection?
A). Acquired characteristics that are inherited are the cause of evolution.
B). The organisms that are the fittest are always largest and strongest.
C). The number of offspring is not related to fitness.
D). More offspring are produced than can possibly survive.
Who suggested that the distance of a galaxy is proportional to its recessional speed
Answer:
Edwin Hubble
Explanation:
Cuales son las características anatómicas de las fosas nasales
PLS HELP! When I let go of a rock it falls down. What happens explain
Answer:
Gravity
Explanation:
Mark as Brainliest
True or false Biodiversity has both economical and ecological value within an ecosystem.
Explanation:
biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.
Which of the following would be classified as a renewable resource?
O A barrel of oil that would take 8 million years to form.
A large piece of coal that would take 4 million years to form.
O Solar rays from the Sun that take 8 minutes to reach the Earth.
O Methane gas from the ocean floor that takes 7 thousand years to outgas.
___________________ is a molecule that organisms get from the air or water around them and use to release energy.
Answer:
Oxygen
Explanation:
In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction
Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?
NO LINKS! NO PDF'S. Please, help ASAP!
Which statement correctly shows the flow of energy in a food chain?
A.
Producer→ heterotroph → decomposer
B.
Producer ← consumer ← decomposer
C.
Autotroph← decomposer ← consumer
D.
Autotroph→ decomposer→ heterotroph
Answer:
Producer→ heterotroph → decomposer
Explanation:
Giving brainlist to whoever answers
Answer:
At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.
Explanation:
Answer:
heterotroph
Explanation:
Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP
molten rocck near ground water supplies
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
Name three reasons why the atmosphere is important to life on earth and explain your reasoning.
The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.
The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.
Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.
Which part always comes FIRST in the scientific name?
Answer:
The first part of the scientific name is the genus, and it is always capitalized. (The plural is "genera"). The second part is the species epithet. The entire name is written in italics.
Explanation:
hope this helps
When sea ice melts, there will be a significant amount of sea level rise.
O True
O False
It will be true, since the ice bergas that fall off can be as big as a 98-164 feet. Form what I have resched
Please!! I’ll give you lots of points!! PHow do the sensory spines most likely help the cockroach
survive in its environment?
A. They improve the cockroach's vision so it can see
predators sooner.
B. They allow the cockroach to change its body shape
to confuse predators.
C. They reduce the friction along the top of the
cockroach so it can move faster than predators.
D. They allow the cockroach to move through small
spaces where it is unable to use its feet to escape
predators.