He IMA FROGGEN GIVE YOU BRAINLIST IF YOU ANSWER RIGHT FOR MEH tezztttt

He IMA FROGGEN GIVE YOU BRAINLIST IF YOU ANSWER RIGHT FOR MEH Tezztttt

Answers

Answer 1

Ogelthorpe's plan did not work as he had expected it to. His plan was to send debtors to work plantations in the colonies instead of sending them to jail. Ogelthorpe also created rules that stated "no one person could own too much land and, alacahol and slavery were banned."  Even though those rules were in place some colonists did find ways to get lots of land as well as bring alcahol and slaves into the colony.  As satated in the passage, "Ogelthorpe had also origanlly wanted to make products that were in high demand in England, such as silk, but soon found that Georgias cilimate was not good for such products."  According to the text corn, rice, tobacco, and indigo became major cash crops since Georgia had a good climate for growing such produce.

Hope this Helped!

Answer 2
It’s because in the passage it says that 50,000 depters were doing work so then they built things so that people can go to their work quicker by road I’m sorry if wrong bc I’m going of the top of my head from my work 3 months ago so sorry if not correct

Related Questions

PLZ HELP WILL GIVE BRAINLY
Why did the US Congress change voting rights in Louisiana just before the territory became a state?


to ensure free people of color could run for office

to make it easier for immigrants to vote in elections

to limit voting rights to men who owned property only

to prevent African Americans from being elected to office

Answers

Answer:

To limit voting rights to men who owned property only.

Because election ndndsnnddjdsjsjddifhvhchcufudjddhdbdjdbdjdbndfbfjdbdjdbjfcbfnbfdndbdjfbfhdndnjdjdjdjfcongress men like to put people and immigrants in to septet pepes

New Amsterdam became a center for trade and shipping becauseImmersive Reader
(5 Points)
a. Of its access to the Hudson and the Atlantic
b. Peter Stuyvesant sold it to the English
c. The Dutch East India Company no longer wanted it
d. The Native Americans sold it for a very little amount

Answers

Answer: I think it's A

Hope this help:)

I think the answer is A

Example of student-written caption: This is an image of Machu Picchu. It has stone walls. The Incas were skilled stoneworkers. They built temples and walls with smooth, cut stones. The stones fit together so well that they did not need any mortar to hold them together.

Requirements: Write a three to five sentence caption for the following six images. Don’t forget that your caption should:

1. Name and describe the image

2. Explain how the image shows the Inca’s contribution to civilization

Make sure to label each of your captions in your file that you send to your instructor. It should look like similar to this example.

Image #1 Social Contribution: (Your caption)
Image #2 Political Contribution: (Your caption)
Image #3 Religious Contribution: (Your caption)
Image #4 Intellectual Contribution: (Your caption)
Image #5 Technological Contribution: (Your caption)
Image #6 Economical Contribution: (Your caption)

Answers

I’m sorry but there are no images how are we supposed to caption something we can’t see?

Match the colony with its description.

Answers

Answer:

North Carolina, land grant to eight noblemen, became a colony of small individual farms

South Carolina, land grant to eight noblemen, became a colony of large slave owning estates

New Jersey, colony named after Sir George Carteret's English home

Pennsylvania, Penn's woods

#6 Delaware

#5 Georgia

Try that.  

Explanation:

Answer:

North Carolina, land grant to eight noblemen, became a colony of small individual farms

South Carolina, land grant to eight noblemen, became a colony of large slave owning estates

New Jersey, colony named after Sir George Carteret's English home

Pennsylvania, Penn's woods

#6 Delaware

#5 Georgia

Try that.  

Explanation:

Identify the factors (new resources, increased productivity, education, technology, slave economy, territorial expansion) that increase economic growth. Describe how the Aztec nation created wealth from the nations surrounding them. (Be sure to cite specific examples from your lesson in your answer.)

Answers

Answer:

Slavery in the Aztec Empire was very different from what Europeans of the same period established in their colonies. Aztec slavery was personal, not hereditary. A slave's children were free. The slave could have possessions and even own other slaves. Slaves could buy their liberty, and could be set free if they were able to show they had been mistreated or if they had children with or were married to their masters.

Typically, upon the death of their owner, slaves who had performed outstanding services were freed, while the rest were passed on as part of the inheritance.

Explanation:

The Aztecs took over other tribes which lead to slavery. The Aztecs sacrificed slaves for the gods they worshipped. They thought the gods needed human sacrifices to stay healthy and happy. During these ceremonies, the slaves would have their hearts taken out while they were still alive.

QUESTION BELOW!!!!!!!!!!!!! ITS MATHHHHHH!!!!!!!!!!

Answers

Answer:

D and E

Explanation:

the graph says it all

All are correct except D

how was the dakota reservation 1851-1863 important

Answers

Answer:

Between it and the Treaty of Mendota, the Dakota were to cede 35 million acres of land at 12 cents an acre in exchange for $3,750,000 to be paid over time—money that they never received.

Explanation:

hope this helps

Many Mexican Texans faced hostility and discrimination because of the -
1.homestead exemption
2.Treaty of Guadalupe Hidalgo
3.1850 census
4.competition for land

Answers

Answer:

2

Explanation:

Many people were angry after the Treaty and blamed the Tejanos.

2 I had that question before

Why did many not consider the emancipation proclamation as legal based on the wording?


12 points...
Also, if you answer correctly, I will mark you as brainliest.....

Answers

Answer:

From the first day of the Civil War, slaves had acted to secure their own liberty. The Emancipation Proclamation confirmed that the insistance that the war for the union must become a war for freedom. It added moral force to the union cause and strengthened them through the military as well as politically.

Explanation:

Becaus of Liberty and the right to freedom

Does anyone know if there are any celebrations/festivals during Hanukkah?

Answers

Answer:

i believe there is a parade for Hanukkah my friend said she went to one

Explanation:

What is a grievance in history?

Answers

Answer:easy I got u

Explanation:

a grievance is something a issue or tax that the colonists did not like that Britain gave.
Therefore they chose not to implement that into there government

Read the passage below to help you answer the question. The following is fictional diary entry of a child living in colonial New England.

Each morning I wake up before dawn. There are many chores that need to be done. First I go out to the barn, milk the cows and collect eggs for breakfast. Next it is time to make sure all of the animals have been fed and then help Father collect wood for the fire. I help Mother churn butter while she makes breakfast.

After breakfast, I got to school. My parents say that school is very important to the future of the colony. We use chalkboards to practice our handwriting and record our answers. Paper is hard to find and very expensive. School sometimes finishes early so all the children can help on the farms. before I leave school, I usually find a few minutes to play marbles and tag with some of the other children. Once I get home, my family and I will work until sunset. We will have a supper of soup and biscuits, and then go tot bed. On Sundays everyone in town goes to church. Then we spend the day playing games and singing songs. After a long week or work and school, it is great to see everyone having so much fun.




In the New England colonies, ______________ worked hard.


A. Everyone
B. Only women
C. Only children
D. Only men

Answers

Answer:

hope it helps

Explanation:

everyone

A.Everyone. That is right

help.

What caused the removal of Khrushchev from government?

failures in the Five-Year Plan
political revolution
failures in foreign relations
citizens' dissension

Answers

Answer:

Failures in foreign relations

Explanation:

Answer: b, political revolution

Explanation: I looked it up

HELP PPEASE WITH 2 & 3!!!!!!

Answers

Answer:

What is the importance of ancestors in Chinese culture?

Explanation:

, What can you infer about undocumented immigrants in Texas?
Select one:

they do not help provide any help to the Texas economy

they are using government programs to live

if they were all deported, it would not effect Texas

they contribute a large portion of taxes


-Latinos and Asians in Texas have purchased power of 297Billion
-Immigrants payed 1.6 billion In texas local state and taxes
-If immigrants leave Texas loses 403,174 JOBS

Answers

Answer:

if they were all deported, it would not effect Texas

Explanation:

they contribute a large portion of texas and if they leave the number of people who pay taxes will decrease

What did Hammurabi's Code call for?
Options: (Requires 1 answer!)

A. Specific punishments for each type of violation of the laws
B. Equal punishments for a crime for all classes of people
C. Monetary fines for all offenses
D. Punishment only for crimes against the government

Answers

Answer:

it is A or B hope it helps

I think. It’s A

Hope it helps

According to the excerpt, what did God disclose to Constantine? also pls give an actual answer to the question and don't put gibberish

Answers

Answer:

if this is about the bible how about you go read it

Explanation:

Answer:

God disclosed  “Do not think that I came to bring peace on earth. I did not come to bring peace but a sword” According to the expert, “matthew 10:53” (document 1). This explains that he wanted his followers to only look at him one way.

I need some help, please

Answers

The fourth one is the best one to choose go for it

Answer:

so i looked it up and one brainly question asked this and someone answered it was A. or 1st one. it was expert varifyed.

I would go with the first one.

Explanation:

I'm sorry i couldn't be of more of a help. :\

Please help me DO ALL FOR BRAIN LIEST !! :D i need help this is due soon!!! any help would be great read directions and read passage to get answers thanks !

Answers

Answer:

1 Improving Babylon

Once he felt the city was safe, he went to work. Hammurabi worked to improve the defenses and infrastructure of the city. He strengthened the city walls, improved the city's irrigation system, and built new temples to the gods. The city became prosperous and grew in power.

2 The Hammurabi code of laws, a collection of 282 rules, established standards for commercial interactions and set fines and punishments to meet the requirements of justice. Hammurabi's Code was carved onto a massive, finger-shaped black stone stele (pillar) that was looted by invaders and finally rediscovered in 1901.

3 The Mesopotamia social hierarchy basically consisted of three classes such as nobility, free citizens and slaves. The hierarchy of Mesopotamia can be symbolized as a triangle shaped pyramid.

Explanation:

I hope this helps!!!

please give me brainliest!!!!

:}

How many humans like cheese?

Answers

Answer:

4 billon

Explanation:

i guess

Calculate the distance between Florida in The U.S. and the island of Cuba.

and Why was this distance a concern to Americans?

Answers

Answer:

the distance was 103 miles and it was a concern because of the missle crisis that happend in 1969

Explanation:

Answer:

thanks lol

Explanation:

30 POINTS! Make a generalization about whether Anne Hutchinson was a role model or a trouble-maker. Use details from the passage to help explain your answer.

Answers

While the Puritan society viewed Anne Hutchinson as a trouble-maker, she should be viewed as a role model. The passage explains that she was a leader in a society where women were not considered leaders. She also encouraged people to think for themselves and interpret the Bible in their own way. Although some people didn’t agree with her, what she was doing was not harming Puritan society. The end of the passage explains why some people may think of Anne Hutchinson as a trouble-maker. However, these claims have nothing to do with what she did. The passage states that puritans had to have strict rules to survive, but Anne Hutchinson’s encouragement to think for oneself does not break any rules that are put in place in order for the Puritans to survive. They were just angry that people weren’t thinking in the same way as them. Anne Hutchinson was most definitely a role model. She inspired people to lead regardless of gender and taught people to think for themselves.

Tax laws _____.
Group of answer choices

A. have to be voted in by the citizens

B. can be proposed to Congress by the President

C. can never be repealed

D. cannot start in the Senate

Answers

Answer:

c

Explanation:

the answer is C
i hope this helps





Use impressment in a sentence about Washington’s presidency.

Answers

Answer:

During Washington's presidency, some British sailors off the coast of America were practicing impressment, in which they would force Americans to work on British ships. ... Washington made treaties to avoid problems.

PLS MARK ME BRAINLIEST

Summarize Jesus’ life according to the gospel.

Answers

Jesus was born, and as he grew older he set good examples and never committed a sin. He then died and got resurrected and during that time the world went dark. And he got hung on a cross for the people that he loves
JESUS IS MY KING AND ALWAYS WILL BE!!❤️❤️❤️

Is this a good story guys??
If not,, can u give me some advice???

Answers

It's blank for me ............…………

Which of the following is true about fossil fuels?
A. Most of them will run out in less than 100 years.
B. They do not produce large amounts of pollution.
C. They can be renewed as we use them.
D. They can only be used as fuel for vehicles.

Answers

Answer:

a

Explanation:

A

Fossil fuels are non renewable sources which means once they run out there’s no more. Since we use them so fast they’re going to run out

Place the following events in sequence:
A) The Black Death hits China;
B) Plague-infested ships land at Messina, Italy;
C) The Black Death hits the Middle East

Answers

c,b,a. trust me :) its the correct answer

Why might the English government have agreed to send debtors to the New World?

Answers

Answer:

i think it is the third answer

Explanation:

Answer: The Colonies needed more workers

Explanation: They needed to send people here so they could work.

What group originally wanted independence in South Africa from Great Britain?

Answers

Answer:

South African War, also called the Second Boer War or the Second War of Independence. A war fought from October 11, 1899, to May 31, 1902

Explanation:

Other Questions
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? What are some real-life situations that require a program that is iterative? Include at least three examples in your answer. Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope. 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. how do you solve 2x plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec What is a society that is able to survive and function over a specified time? Community health problems can be addressed through the provision of health education. Justify it Moritz rescued his friend from a dangerous ocean rip current by pulling his friend from the water. Which activity most likely prepared him for this?enrolling in a class about swimming safetytaking a CPR training classwatching online shows about being a lifeguardtalking with friends who are lifeguards 2000x5000000000000000000000000000 PLEASE HELP Write the point-slope form of the equation of the line through the given points.3) through: (4, 5) and (0, 2) in having trouble can someone help me please During the basketball season, diane took 134 shots and made about 56% of them. a.) how many shots did diane make? b.) the team made a total of 498 shots. what precent of the teams made shots did diane make